EMAIL THIS PAGE TO A FRIEND

ACOT4

acyl-CoA thioesterase 4

48 Gene Product Result for
Synonyms: PTE-Ib PTE1B PTE2B
UniProtKB ID: Q8N9L9, Q17RF4, Q5BKT6, Q86TX0, Q86TX1, Q96N88
Gene ID:
Mouse(171282) acyl-CoA thioesterase 4
Rat(681337) acyl-CoA thioesterase 4
domestic guinea pig(100730202) acyl-CoA thioesterase 4
naked mole-rat(101728312) acyl-CoA thioesterase 4
chicken(428872) acyl-CoA thioesterase 4
domestic cat(101092524) acyl-CoA thioesterase 4
cow(511431) acyl-CoA thioesterase 4
dog(490771) acyl-CoA thioesterase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152331 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152331 Rosetta Predictions human pricing
NM_001109440 Rosetta Predictions rat pricing
NM_134247 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365929 predicted 1122
2 SASI_Hs01_00241761 predicted 1140
3 SASI_Hs01_00241762 predicted 879
4 SASI_Hs01_00241763 predicted 1370
5 SASI_Hs01_00241766 predicted 847
6 SASI_Hs01_00241767 predicted 1167
7 SASI_Hs01_00241768 predicted 1251
8 SASI_Hs01_00241769 predicted 953
9 SASI_Hs01_00241770 predicted 952
10 SASI_Hs02_00365930 predicted 802
11 SASI_Hs01_00241764 predicted 842
12 SASI_Hs01_00241765 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248427 predicted 818
2 SASI_Rn02_00248428 predicted 702
3 SASI_Rn02_00248429 predicted 712
4 SASI_Rn02_00248430 predicted 732
5 SASI_Rn02_00248431 predicted 883
6 SASI_Rn02_00248432 predicted 701
7 SASI_Rn02_00248433 predicted 715
8 SASI_Rn02_00248434 predicted 997
9 SASI_Rn02_00248435 predicted 901
10 SASI_Rn02_00248436 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179311 predicted 908
2 SASI_Mm01_00179312 predicted 1298
3 SASI_Mm01_00179313 predicted 1321
4 SASI_Mm01_00179314 predicted 997
5 SASI_Mm01_00179315 predicted 605
6 SASI_Mm01_00179316 predicted 714
7 SASI_Mm01_00179317 predicted 767
8 SASI_Mm01_00179318 predicted 737
9 SASI_Mm01_00179319 predicted 921
10 SASI_Mm01_00179320 predicted 1414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152331
ACOT4 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1453s21c1
Sequence:CCGGAGCAAATTCTAGCCTTCTTCTCTCGAGAGAAGAAGGCTAGAATTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1503s21c1
Sequence:CCGGGCTGTCCCTAAATTGTAATGCCTCGAGGCATTACAATTTAGGGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1260s21c1
Sequence:CCGGCAAACAGTCTCTGAACGGTTACTCGAGTAACCGTTCAGAGACTGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1148s21c1
Sequence:CCGGTCTCGTAGGAGGGTACAAGAACTCGAGTTCTTGTACCCTCCTACGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-577s1c1
Sequence:CCGGCGTTGGATCTTCAAAGTTATACTCGAGTATAACTTTGAAGATCCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-827s1c1
Sequence:CCGGGCACAGTAGCATTCCACCATTCTCGAGAATGGTGGAATGCTACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-1100s1c1
Sequence:CCGGGCATTACATCGAGCCTCCTTACTCGAGTAAGGAGGCTCGATGTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-612s1c1
Sequence:CCGGCCCAATAACATGGACAACATACTCGAGTATGTTGTCCATGTTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-495s1c1
Sequence:CCGGCCAGGGATCATTGACATCTTTCTCGAGAAAGATGTCAATGATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152331
ACOT4 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1453s21c1
Sequence:CCGGAGCAAATTCTAGCCTTCTTCTCTCGAGAGAAGAAGGCTAGAATTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1503s21c1
Sequence:CCGGGCTGTCCCTAAATTGTAATGCCTCGAGGCATTACAATTTAGGGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1260s21c1
Sequence:CCGGCAAACAGTCTCTGAACGGTTACTCGAGTAACCGTTCAGAGACTGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1148s21c1
Sequence:CCGGTCTCGTAGGAGGGTACAAGAACTCGAGTTCTTGTACCCTCCTACGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-577s1c1
Sequence:CCGGCGTTGGATCTTCAAAGTTATACTCGAGTATAACTTTGAAGATCCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-827s1c1
Sequence:CCGGGCACAGTAGCATTCCACCATTCTCGAGAATGGTGGAATGCTACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-1100s1c1
Sequence:CCGGGCATTACATCGAGCCTCCTTACTCGAGTAAGGAGGCTCGATGTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-612s1c1
Sequence:CCGGCCCAATAACATGGACAACATACTCGAGTATGTTGTCCATGTTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-495s1c1
Sequence:CCGGCCAGGGATCATTGACATCTTTCTCGAGAAAGATGTCAATGATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152331
ACOT4 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1453s21c1
Sequence:CCGGAGCAAATTCTAGCCTTCTTCTCTCGAGAGAAGAAGGCTAGAATTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1503s21c1
Sequence:CCGGGCTGTCCCTAAATTGTAATGCCTCGAGGCATTACAATTTAGGGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1260s21c1
Sequence:CCGGCAAACAGTCTCTGAACGGTTACTCGAGTAACCGTTCAGAGACTGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152331.3-1148s21c1
Sequence:CCGGTCTCGTAGGAGGGTACAAGAACTCGAGTTCTTGTACCCTCCTACGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-577s1c1
Sequence:CCGGCGTTGGATCTTCAAAGTTATACTCGAGTATAACTTTGAAGATCCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-827s1c1
Sequence:CCGGGCACAGTAGCATTCCACCATTCTCGAGAATGGTGGAATGCTACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-1100s1c1
Sequence:CCGGGCATTACATCGAGCCTCCTTACTCGAGTAAGGAGGCTCGATGTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-612s1c1
Sequence:CCGGCCCAATAACATGGACAACATACTCGAGTATGTTGTCCATGTTATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152331.1-495s1c1
Sequence:CCGGCCAGGGATCATTGACATCTTTCTCGAGAAAGATGTCAATGATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134247
ACOT4 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134247.2-1838s1c1
Sequence:CCGGCCCTACCTAGTTAATACTTTACTCGAGTAAAGTATTAACTAGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-604s1c1
Sequence:CCGGCCAGGCATCATCGATGTTTATCTCGAGATAAACATCGATGATGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-777s1c1
Sequence:CCGGGCTTCGACATCCAAAGGTAAACTCGAGTTTACCTTTGGATGTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-1049s1c1
Sequence:CCGGCCAGCATGATACCAATAGAGACTCGAGTCTCTATTGGTATCATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-1218s1c1
Sequence:CCGGCGAACCACCTTACTTTCCCATCTCGAGATGGGAAAGTAAGGTGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134247
ACOT4 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134247.2-1838s1c1
Sequence:CCGGCCCTACCTAGTTAATACTTTACTCGAGTAAAGTATTAACTAGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-604s1c1
Sequence:CCGGCCAGGCATCATCGATGTTTATCTCGAGATAAACATCGATGATGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-777s1c1
Sequence:CCGGGCTTCGACATCCAAAGGTAAACTCGAGTTTACCTTTGGATGTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-1049s1c1
Sequence:CCGGCCAGCATGATACCAATAGAGACTCGAGTCTCTATTGGTATCATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-1218s1c1
Sequence:CCGGCGAACCACCTTACTTTCCCATCTCGAGATGGGAAAGTAAGGTGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134247
ACOT4 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134247.2-1838s1c1
Sequence:CCGGCCCTACCTAGTTAATACTTTACTCGAGTAAAGTATTAACTAGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-604s1c1
Sequence:CCGGCCAGGCATCATCGATGTTTATCTCGAGATAAACATCGATGATGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-777s1c1
Sequence:CCGGGCTTCGACATCCAAAGGTAAACTCGAGTTTACCTTTGGATGTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-1049s1c1
Sequence:CCGGCCAGCATGATACCAATAGAGACTCGAGTCTCTATTGGTATCATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134247.2-1218s1c1
Sequence:CCGGCGAACCACCTTACTTTCCCATCTCGAGATGGGAAAGTAAGGTGGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)