EMAIL THIS PAGE TO A FRIEND

ACOT6

acyl-CoA thioesterase 6

59 Gene Product Result for
Synonyms: C14orf42 c14_5530
UniProtKB ID: Q3I5F7
Gene ID:
Mouse(217700) acyl-CoA thioesterase 6
Rat(299193) acyl-CoA thioesterase 6
naked mole-rat(101709781) acyl-CoA thioesterase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA058258 Anti-ACOT6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037162 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037162 Rosetta Predictions human pricing
XM_234402 Rosetta Predictions rat pricing
NM_172580 Rosetta Predictions mouse pricing
XM_126946 Rosetta Predictions mouse pricing
XM_900185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033140 predicted 762
2 SASI_Hs01_00033141 predicted 684
3 SASI_Hs01_00033139 predicted 763
4 SASI_Hs01_00033143 predicted 468
5 SASI_Hs01_00033144 predicted 588
6 SASI_Hs01_00033145 predicted 342
7 SASI_Hs01_00033146 predicted 419
8 SASI_Hs01_00033147 predicted 573
9 SASI_Hs01_00033148 predicted 410
10 SASI_Hs01_00033142 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388449 predicted 1066
2 SASI_Rn02_00388450 predicted 631
3 SASI_Rn02_00388451 predicted 1094
4 SASI_Rn02_00388452 predicted 529
5 SASI_Rn02_00388453 predicted 660
6 SASI_Rn02_00388454 predicted 727
7 SASI_Rn02_00388455 predicted 667
8 SASI_Rn02_00388456 predicted 982
9 SASI_Rn02_00388457 predicted 870
10 SASI_Rn02_00388458 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344248 predicted 1106
2 SASI_Mm02_00344249 predicted 975
3 SASI_Mm02_00344250 predicted 1174
4 SASI_Mm02_00344251 predicted 1091
5 SASI_Mm02_00344252 predicted 877
6 SASI_Mm02_00344253 predicted 1296
7 SASI_Mm02_00344254 predicted 803
8 SASI_Mm02_00344255 predicted 913
9 SASI_Mm02_00344256 predicted 1253
10 SASI_Mm02_00344257 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284129 predicted 1419
2 SASI_Mm01_00284130 predicted 1421
3 SASI_Mm01_00284131 predicted 1421
4 SASI_Mm01_00284132 predicted 1415
5 SASI_Mm01_00284133 predicted 1416
6 SASI_Mm01_00284134 predicted 1121
7 SASI_Mm01_00284135 predicted 1171
8 SASI_Mm01_00284136 predicted 1104
9 SASI_Mm01_00284137 predicted 880
10 SASI_Mm01_00284138 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234394 predicted 1133
2 SASI_Mm01_00234395 predicted 1127
3 SASI_Mm01_00234396 predicted 904
4 SASI_Mm01_00234397 predicted 1255
5 SASI_Mm01_00234398 predicted 909
6 SASI_Mm01_00234399 predicted 1113
7 SASI_Mm01_00234400 predicted 870
8 SASI_Mm01_00234401 predicted 1085
9 SASI_Mm01_00234402 predicted 1047
10 SASI_Mm01_00234403 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037162
ACOT6 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 6
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-506s1c1
Sequence:CCGGCCTAAACTTGTCGATGATCTACTCGAGTAGATCATCGACAAGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-739s1c1
Sequence:CCGGCCAGATAATCTGTTACCCAGACTCGAGTCTGGGTAACAGATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-605s1c1
Sequence:CCGGCAAAGTCTTGTTCCATTGGAACTCGAGTTCCAATGGAACAAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-652s1c1
Sequence:CCGGTGTTGGCATGGATGATCAAAGCTCGAGCTTTGATCATCCATGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037162
ACOT6 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 6
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-506s1c1
Sequence:CCGGCCTAAACTTGTCGATGATCTACTCGAGTAGATCATCGACAAGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-739s1c1
Sequence:CCGGCCAGATAATCTGTTACCCAGACTCGAGTCTGGGTAACAGATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-605s1c1
Sequence:CCGGCAAAGTCTTGTTCCATTGGAACTCGAGTTCCAATGGAACAAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-652s1c1
Sequence:CCGGTGTTGGCATGGATGATCAAAGCTCGAGCTTTGATCATCCATGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037162
ACOT6 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 6
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-506s1c1
Sequence:CCGGCCTAAACTTGTCGATGATCTACTCGAGTAGATCATCGACAAGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-739s1c1
Sequence:CCGGCCAGATAATCTGTTACCCAGACTCGAGTCTGGGTAACAGATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-605s1c1
Sequence:CCGGCAAAGTCTTGTTCCATTGGAACTCGAGTTCCAATGGAACAAGACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037162.1-652s1c1
Sequence:CCGGTGTTGGCATGGATGATCAAAGCTCGAGCTTTGATCATCCATGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172580
ACOT6 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-870s21c1
Sequence:CCGGCGTGCTTGCCCTGGCTTATTTCTCGAGAAATAAGCCAGGGCAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-974s21c1
Sequence:CCGGCTCAGGTGAAAGGCCCAAATACTCGAGTATTTGGGCCTTTCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172580.1-1590s21c1
Sequence:CCGGTATCGAAAGTTCTAATCATGCCTCGAGGCATGATTAGAACTTTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-923s21c1
Sequence:CCGGACGTTCGCCTGGAGTACTTTGCTCGAGCAAAGTACTCCAGGCGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-1304s21c1
Sequence:CCGGGTGACGTCTATGCTCGTATAGCTCGAGCTATACGAGCATAGACGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172580
ACOT6 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-870s21c1
Sequence:CCGGCGTGCTTGCCCTGGCTTATTTCTCGAGAAATAAGCCAGGGCAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-974s21c1
Sequence:CCGGCTCAGGTGAAAGGCCCAAATACTCGAGTATTTGGGCCTTTCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172580.1-1590s21c1
Sequence:CCGGTATCGAAAGTTCTAATCATGCCTCGAGGCATGATTAGAACTTTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-923s21c1
Sequence:CCGGACGTTCGCCTGGAGTACTTTGCTCGAGCAAAGTACTCCAGGCGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-1304s21c1
Sequence:CCGGGTGACGTCTATGCTCGTATAGCTCGAGCTATACGAGCATAGACGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172580
ACOT6 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-870s21c1
Sequence:CCGGCGTGCTTGCCCTGGCTTATTTCTCGAGAAATAAGCCAGGGCAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-974s21c1
Sequence:CCGGCTCAGGTGAAAGGCCCAAATACTCGAGTATTTGGGCCTTTCACCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172580.1-1590s21c1
Sequence:CCGGTATCGAAAGTTCTAATCATGCCTCGAGGCATGATTAGAACTTTCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-923s21c1
Sequence:CCGGACGTTCGCCTGGAGTACTTTGCTCGAGCAAAGTACTCCAGGCGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172580.1-1304s21c1
Sequence:CCGGGTGACGTCTATGCTCGTATAGCTCGAGCTATACGAGCATAGACGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks