EMAIL THIS PAGE TO A FRIEND

ACOT7

acyl-CoA thioesterase 7

97 Gene Product Result for
Synonyms: ACH1 ACT BACH CTE-II LACH LACH1 RP1-120G22.10 hBACH
Gene ID:
Human(11332) Summary: This gene encodes a member of the acyl coenzyme family. The encoded protein hydrolyzes the CoA thioester of palmitoyl-CoA and other long-chain fatty acids. Decreased expression of this gene may be associated with mesial temporal lobe epilepsy. Alternatively spliced transcript variants encoding distinct isoforms with different subcellular locations have been characterized. [provided by RefSeq, Jul 2008]
Mouse(70025) acyl-CoA thioesterase 7
Rat(26759) acyl-CoA thioesterase 7
Zebrafish(447878) acyl-CoA thioesterase 7
cow(514788) acyl-CoA thioesterase 7
chicken(419371) acyl-CoA thioesterase 7
domestic cat(101090371) acyl-CoA thioesterase 7
dog(479589) acyl-CoA thioesterase 7
naked mole-rat(101705865) acyl-CoA thioesterase 7
domestic guinea pig(100725212) acyl-CoA thioesterase 7
sheep(101121789) acyl-CoA thioesterase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133348 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133348 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133348 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007274 Rosetta Predictions human pricing
NM_181864 Rosetta Predictions human pricing
NM_181865 Rosetta Predictions human pricing
NM_181866 Rosetta Predictions human pricing
NM_013214 Rosetta Predictions rat pricing
NM_133348 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112714 predicted 1528
2 SASI_Hs01_00112715 predicted 1567
3 SASI_Hs02_00343324 predicted 1142
4 SASI_Hs01_00112716 predicted 1398
5 SASI_Hs01_00112718 predicted 1267
6 SASI_Hs01_00112720 predicted 1152
7 SASI_Hs01_00112721 predicted 1046
8 SASI_Hs02_00343325 predicted 1244
9 SASI_Hs02_00343326 predicted 826
10 SASI_Hs02_00343327 predicted 1413
11 SASI_Hs01_00112717 predicted 1084
12 SASI_Hs01_00112719 predicted 1075
13 SASI_Hs01_00112722 predicted 1315
14 SASI_Hs01_00112723 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169273 predicted 1345
2 SASI_Hs01_00169274 predicted 1393
3 SASI_Hs02_00370449 predicted 965
4 SASI_Hs01_00169275 predicted 1218
5 SASI_Hs01_00169277 predicted 1095
6 SASI_Hs01_00169279 predicted 968
7 SASI_Hs01_00169280 predicted 863
8 SASI_Hs02_00370450 predicted 1057
9 SASI_Hs02_00370451 predicted 653
10 SASI_Hs02_00370452 predicted 1232
11 SASI_Hs01_00169276 predicted 902
12 SASI_Hs01_00169278 predicted 896
13 SASI_Hs01_00169281 predicted 1139
14 SASI_Hs01_00169282 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064680 predicted 1148
2 SASI_Hs01_00064681 predicted 1198
3 SASI_Hs02_00370453 predicted 772
4 SASI_Hs01_00064682 predicted 1027
5 SASI_Hs01_00064684 predicted 895
6 SASI_Hs01_00064686 predicted 773
7 SASI_Hs01_00064687 predicted 671
8 SASI_Hs02_00370454 predicted 861
9 SASI_Hs02_00370455 predicted 451
10 SASI_Hs02_00370456 predicted 1043
11 SASI_Hs01_00064683 predicted 704
12 SASI_Hs01_00064685 predicted 705
13 SASI_Hs01_00064688 predicted 937
14 SASI_Hs01_00064689 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205555 predicted 1129
2 SASI_Hs01_00205556 predicted 1180
3 SASI_Hs02_00370457 predicted 751
4 SASI_Hs01_00205557 predicted 1009
5 SASI_Hs01_00205559 predicted 880
6 SASI_Hs01_00205561 predicted 757
7 SASI_Hs01_00205562 predicted 654
8 SASI_Hs02_00370458 predicted 851
9 SASI_Hs02_00370459 predicted 435
10 SASI_Hs02_00370460 predicted 1026
11 SASI_Hs01_00205558 predicted 685
12 SASI_Hs01_00205560 predicted 686
13 SASI_Hs01_00205563 predicted 929
14 SASI_Hs01_00205564 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053673 predicted 297
2 SASI_Rn01_00053674 predicted 408
3 SASI_Rn01_00053675 predicted 818
4 SASI_Rn01_00053676 predicted 799
5 SASI_Rn01_00053677 predicted 687
6 SASI_Rn01_00053678 predicted 343
7 SASI_Rn01_00053679 predicted 728
8 SASI_Rn01_00053680 predicted 781
9 SASI_Rn01_00053682 predicted 552
10 SASI_Rn02_00261075 predicted 595
11 SASI_Rn01_00053681 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172112 predicted 1223
2 SASI_Mm01_00172113 predicted 467
3 SASI_Mm02_00338527 predicted 445
4 SASI_Mm01_00172114 predicted 862
5 SASI_Mm01_00172115 predicted 1207
6 SASI_Mm01_00172116 predicted 466
7 SASI_Mm01_00172117 predicted 967
8 SASI_Mm01_00172118 predicted 1216
9 SASI_Mm01_00172119 predicted 876
10 SASI_Mm01_00172120 predicted 640
11 SASI_Mm01_00172121 predicted 1200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133348
VALIDATED
ACOT7 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133348.2-1257s21c1
Sequence:CCGGAGTATGCAGTCACTTAGAAATCTCGAGATTTCTAAGTGACTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133348.2-527s21c1
Sequence:CCGGGCTGACCAATAAAGCCACCTTCTCGAGAAGGTGGCTTTATTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133348.1-933s1c1
Sequence:CCGGGCAATAAGTCCATGGAGATTGCTCGAGCAATCTCCATGGACTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133348.1-255s1c1
Sequence:CCGGGGACCATTCTGAAGATGATTGCTCGAGCAATCATCTTCAGAATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133348.2-442s21c1
Sequence:CCGGGTGCAGAGATCACCTACACTTCTCGAGAAGTGTAGGTGATCTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133348.2-951s21c1
Sequence:CCGGCGCATGACCTTCACAAGCAATCTCGAGATTGCTTGTGAAGGTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133348.1-1091s1c1
Sequence:CCGGGATGAGAAGAAGCGCTTCGAACTCGAGTTCGAAGCGCTTCTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133348.1-493s1c1
Sequence:CCGGGCTGACCAATAAAGCCACCTTCTCGAGAAGGTGGCTTTATTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133348.1-241s1c1
Sequence:CCGGCAATGTTCATGGAGGGACCATCTCGAGATGGTCCCTCCATGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133348.1-408s1c1
Sequence:CCGGGTGCAGAGATCACCTACACTTCTCGAGAAGTGTAGGTGATCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133348.1-917s1c1
Sequence:CCGGCGCATGACCTTCACAAGCAATCTCGAGATTGCTTGTGAAGGTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133348
VALIDATED
ACOT7 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133348.2-1257s21c1
Sequence:CCGGAGTATGCAGTCACTTAGAAATCTCGAGATTTCTAAGTGACTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133348.2-527s21c1
Sequence:CCGGGCTGACCAATAAAGCCACCTTCTCGAGAAGGTGGCTTTATTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133348.1-933s1c1
Sequence:CCGGGCAATAAGTCCATGGAGATTGCTCGAGCAATCTCCATGGACTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133348.1-255s1c1
Sequence:CCGGGGACCATTCTGAAGATGATTGCTCGAGCAATCATCTTCAGAATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133348.2-442s21c1
Sequence:CCGGGTGCAGAGATCACCTACACTTCTCGAGAAGTGTAGGTGATCTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133348.2-951s21c1
Sequence:CCGGCGCATGACCTTCACAAGCAATCTCGAGATTGCTTGTGAAGGTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133348.1-1091s1c1
Sequence:CCGGGATGAGAAGAAGCGCTTCGAACTCGAGTTCGAAGCGCTTCTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133348.1-493s1c1
Sequence:CCGGGCTGACCAATAAAGCCACCTTCTCGAGAAGGTGGCTTTATTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133348.1-241s1c1
Sequence:CCGGCAATGTTCATGGAGGGACCATCTCGAGATGGTCCCTCCATGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133348.1-408s1c1
Sequence:CCGGGTGCAGAGATCACCTACACTTCTCGAGAAGTGTAGGTGATCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133348.1-917s1c1
Sequence:CCGGCGCATGACCTTCACAAGCAATCTCGAGATTGCTTGTGAAGGTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133348
VALIDATED
ACOT7 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133348.2-1257s21c1
Sequence:CCGGAGTATGCAGTCACTTAGAAATCTCGAGATTTCTAAGTGACTGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133348.2-527s21c1
Sequence:CCGGGCTGACCAATAAAGCCACCTTCTCGAGAAGGTGGCTTTATTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133348.1-933s1c1
Sequence:CCGGGCAATAAGTCCATGGAGATTGCTCGAGCAATCTCCATGGACTTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133348.1-255s1c1
Sequence:CCGGGGACCATTCTGAAGATGATTGCTCGAGCAATCATCTTCAGAATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133348.2-442s21c1
Sequence:CCGGGTGCAGAGATCACCTACACTTCTCGAGAAGTGTAGGTGATCTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133348.2-951s21c1
Sequence:CCGGCGCATGACCTTCACAAGCAATCTCGAGATTGCTTGTGAAGGTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133348.1-1091s1c1
Sequence:CCGGGATGAGAAGAAGCGCTTCGAACTCGAGTTCGAAGCGCTTCTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133348.1-493s1c1
Sequence:CCGGGCTGACCAATAAAGCCACCTTCTCGAGAAGGTGGCTTTATTGGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133348.1-241s1c1
Sequence:CCGGCAATGTTCATGGAGGGACCATCTCGAGATGGTCCCTCCATGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133348.1-408s1c1
Sequence:CCGGGTGCAGAGATCACCTACACTTCTCGAGAAGTGTAGGTGATCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133348.1-917s1c1
Sequence:CCGGCGCATGACCTTCACAAGCAATCTCGAGATTGCTTGTGAAGGTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181862
VALIDATED
ACOT7 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181862.1-828s1c1
Sequence:CCGGGTCGCTGAAGAATGTGGACAACTCGAGTTGTCCACATTCTTCAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181862.1-1133s1c1
Sequence:CCGGAGACCAACATCGTCACAGCTTCTCGAGAAGCTGTGACGATGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_181862.1-600s1c1
Sequence:CCGGCCGGCATTGCAACAGCCAGAACTCGAGTTCTGGCTGTTGCAATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_181862.1-857s1c1
Sequence:CCGGAGGTGCCTCCTGTTGTGTATTCTCGAGAATACACAACAGGAGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181862.1-1078s1c1
Sequence:CCGGGTGACCATGAAGCTCATGGATCTCGAGATCCATGAGCTTCATGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181862
VALIDATED
ACOT7 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181862.1-828s1c1
Sequence:CCGGGTCGCTGAAGAATGTGGACAACTCGAGTTGTCCACATTCTTCAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181862.1-1133s1c1
Sequence:CCGGAGACCAACATCGTCACAGCTTCTCGAGAAGCTGTGACGATGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_181862.1-600s1c1
Sequence:CCGGCCGGCATTGCAACAGCCAGAACTCGAGTTCTGGCTGTTGCAATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_181862.1-857s1c1
Sequence:CCGGAGGTGCCTCCTGTTGTGTATTCTCGAGAATACACAACAGGAGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181862.1-1078s1c1
Sequence:CCGGGTGACCATGAAGCTCATGGATCTCGAGATCCATGAGCTTCATGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181862
VALIDATED
ACOT7 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181862.1-828s1c1
Sequence:CCGGGTCGCTGAAGAATGTGGACAACTCGAGTTGTCCACATTCTTCAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181862.1-1133s1c1
Sequence:CCGGAGACCAACATCGTCACAGCTTCTCGAGAAGCTGTGACGATGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_181862.1-600s1c1
Sequence:CCGGCCGGCATTGCAACAGCCAGAACTCGAGTTCTGGCTGTTGCAATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_181862.1-857s1c1
Sequence:CCGGAGGTGCCTCCTGTTGTGTATTCTCGAGAATACACAACAGGAGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181862.1-1078s1c1
Sequence:CCGGGTGACCATGAAGCTCATGGATCTCGAGATCCATGAGCTTCATGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks