EMAIL THIS PAGE TO A FRIEND

ACOT8

acyl-CoA thioesterase 8

76 Gene Product Result for
Synonyms: HNAACTE PTE-1 PTE-2 PTE1 PTE2 hACTE-III hTE
UniProtKB ID: O14734, O15261, Q17RX4
Gene ID:
Human(10005) Summary: The protein encoded by this gene is a peroxisomal thioesterase that appears to be involved more in the oxidation of fatty acids rather than in their formation. The encoded protein can bind to the human immunodeficiency virus-1 protein Nef, and mediate Nef-induced down-regulation of CD4 in T-cells. [provided by RefSeq, Oct 2010]
Mouse(170789) acyl-CoA thioesterase 8
Rat(170588) acyl-CoA thioesterase 8
sheep(101115474) acyl-CoA thioesterase 8
domestic guinea pig(100728225) acyl-CoA thioesterase 8
naked mole-rat(101723404) acyl-CoA thioesterase 8
Zebrafish(450052) acyl-CoA thioesterase 8
cow(504360) acyl-CoA thioesterase 8
Horse(100056378) acyl-CoA thioesterase 8
domestic cat(101086550) acyl-CoA thioesterase 8
dog(477247) acyl-CoA thioesterase 8
chicken(419303) acyl-CoA thioesterase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005469 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133240 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133240 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133240 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005469 Rosetta Predictions human pricing
NM_183385 Rosetta Predictions human pricing
NM_183386 Rosetta Predictions human pricing
NM_130756 Rosetta Predictions rat pricing
NM_133240 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339633 predicted 280
2 SASI_Hs02_00339634 predicted 234
3 SASI_Hs02_00339635 predicted 407
4 SASI_Hs02_00339636 predicted 390
5 SASI_Hs02_00339637 predicted 389
6 SASI_Hs02_00339638 predicted 403
7 SASI_Hs02_00339639 predicted 341
8 SASI_Hs02_00339640 predicted 381
9 SASI_Hs02_00339641 predicted 315
10 SASI_Hs02_00339642 predicted 225
11 SASI_Hs01_00209436 predicted 764
12 SASI_Hs01_00209437 predicted 718
13 SASI_Hs01_00209438 predicted 600
14 SASI_Hs01_00209439 predicted 878
15 SASI_Hs01_00209440 predicted 597
16 SASI_Hs01_00209441 predicted 681
17 SASI_Hs01_00209442 predicted 594
18 SASI_Hs01_00209443 predicted 553
19 SASI_Hs01_00209444 predicted 821
20 SASI_Hs01_00209445 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185388 predicted 631
2 SASI_Hs01_00185389 predicted 590
3 SASI_Hs01_00185390 predicted 457
4 SASI_Hs01_00185391 predicted 746
5 SASI_Hs01_00185392 predicted 457
6 SASI_Hs01_00185393 predicted 547
7 SASI_Hs01_00185394 predicted 465
8 SASI_Hs01_00185395 predicted 413
9 SASI_Hs01_00185396 predicted 686
10 SASI_Hs01_00185397 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022731 predicted 282
2 SASI_Hs01_00022732 predicted 238
3 SASI_Hs01_00022733 predicted 403
4 SASI_Hs02_00371295 predicted 391
5 SASI_Hs01_00022734 predicted 393
6 SASI_Hs01_00022735 predicted 412
7 SASI_Hs01_00022736 predicted 346
8 SASI_Hs01_00022737 predicted 380
9 SASI_Hs01_00022738 predicted 322
10 SASI_Hs01_00022739 predicted 227
11 SASI_Hs01_00022740 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044928 predicted 1109
2 SASI_Rn01_00044929 predicted 484
3 SASI_Rn01_00044930 predicted 1059
4 SASI_Rn01_00044931 predicted 397
5 SASI_Rn01_00044932 predicted 1112
6 SASI_Rn01_00044933 predicted 1185
7 SASI_Rn01_00044934 predicted 515
8 SASI_Rn01_00044936 predicted 481
9 SASI_Rn01_00044937 predicted 1065
10 SASI_Rn02_00267495 predicted 504
11 SASI_Rn01_00044935 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119457 predicted 394
2 SASI_Mm01_00119458 predicted 552
3 SASI_Mm01_00119459 predicted 738
4 SASI_Mm01_00119460 predicted 865
5 SASI_Mm01_00119461 predicted 264
6 SASI_Mm01_00119462 predicted 611
7 SASI_Mm01_00119463 predicted 789
8 SASI_Mm01_00119464 predicted 365
9 SASI_Mm01_00119465 predicted 756
10 SASI_Mm01_00119466 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005469
VALIDATED
ACOT8 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-558s1c1
Sequence:CCGGCCAGTATTTAAGGGACCCTAACTCGAGTTAGGGTCCCTTAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-631s1c1
Sequence:CCGGCCCATTGAGATCAAGCCAGTACTCGAGTACTGGCTTGATCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-760s1c1
Sequence:CCGGGCCGCCTATATCTCCGACTATCTCGAGATAGTCGGAGATATAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-409s1c1
Sequence:CCGGCGCTCTGTGAAGGCCGTGCAACTCGAGTTGCACGGCCTTCACAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-544s1c1
Sequence:CCGGGAGACCCTCATTGACCAGTATCTCGAGATACTGGTCAATGAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-634s21c1
Sequence:CCGGATTGAGATCAAGCCAGTAAACCTCGAGGTTTACTGGCTTGATCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-596s21c1
Sequence:CCGGCATTGGCGCTCAACCGAATTGCTCGAGCAATTCGGTTGAGCGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-546s21c1
Sequence:CCGGGACCCTCATTGACCAGTATTTCTCGAGAAATACTGGTCAATGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-881s21c1
Sequence:CCGGCTGACCACTGGATGCTCTATGCTCGAGCATAGAGCATCCAGTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-761s21c1
Sequence:CCGGCCGCCTATATCTCCGACTATGCTCGAGCATAGTCGGAGATATAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005469
VALIDATED
ACOT8 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-558s1c1
Sequence:CCGGCCAGTATTTAAGGGACCCTAACTCGAGTTAGGGTCCCTTAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-631s1c1
Sequence:CCGGCCCATTGAGATCAAGCCAGTACTCGAGTACTGGCTTGATCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-760s1c1
Sequence:CCGGGCCGCCTATATCTCCGACTATCTCGAGATAGTCGGAGATATAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-409s1c1
Sequence:CCGGCGCTCTGTGAAGGCCGTGCAACTCGAGTTGCACGGCCTTCACAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-544s1c1
Sequence:CCGGGAGACCCTCATTGACCAGTATCTCGAGATACTGGTCAATGAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-634s21c1
Sequence:CCGGATTGAGATCAAGCCAGTAAACCTCGAGGTTTACTGGCTTGATCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-596s21c1
Sequence:CCGGCATTGGCGCTCAACCGAATTGCTCGAGCAATTCGGTTGAGCGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-546s21c1
Sequence:CCGGGACCCTCATTGACCAGTATTTCTCGAGAAATACTGGTCAATGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-881s21c1
Sequence:CCGGCTGACCACTGGATGCTCTATGCTCGAGCATAGAGCATCCAGTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-761s21c1
Sequence:CCGGCCGCCTATATCTCCGACTATGCTCGAGCATAGTCGGAGATATAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005469
VALIDATED
ACOT8 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-558s1c1
Sequence:CCGGCCAGTATTTAAGGGACCCTAACTCGAGTTAGGGTCCCTTAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-631s1c1
Sequence:CCGGCCCATTGAGATCAAGCCAGTACTCGAGTACTGGCTTGATCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-760s1c1
Sequence:CCGGGCCGCCTATATCTCCGACTATCTCGAGATAGTCGGAGATATAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-409s1c1
Sequence:CCGGCGCTCTGTGAAGGCCGTGCAACTCGAGTTGCACGGCCTTCACAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005469.2-544s1c1
Sequence:CCGGGAGACCCTCATTGACCAGTATCTCGAGATACTGGTCAATGAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-634s21c1
Sequence:CCGGATTGAGATCAAGCCAGTAAACCTCGAGGTTTACTGGCTTGATCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-596s21c1
Sequence:CCGGCATTGGCGCTCAACCGAATTGCTCGAGCAATTCGGTTGAGCGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-546s21c1
Sequence:CCGGGACCCTCATTGACCAGTATTTCTCGAGAAATACTGGTCAATGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-881s21c1
Sequence:CCGGCTGACCACTGGATGCTCTATGCTCGAGCATAGAGCATCCAGTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005469.2-761s21c1
Sequence:CCGGCCGCCTATATCTCCGACTATGCTCGAGCATAGTCGGAGATATAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133240
VALIDATED
ACOT8 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-833s1c1
Sequence:CCGGGATCACTCCATGTGGTTTCATCTCGAGATGAAACCACATGGAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-271s1c1
Sequence:CCGGCAAGTCTGTGAGTGAAGACGTCTCGAGACGTCTTCACTCACAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-561s21c1
Sequence:CCGGCTAACCTTCACAAGAAGTATCCTCGAGGATACTTCTTGTGAAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-1006s1c1
Sequence:CCGGGGTGTCAGAGAGTAAGCTATACTCGAGTATAGCTTACTCTCTGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-534s1c1
Sequence:CCGGCCCTCATTGACCAGTACTTAACTCGAGTTAAGTACTGGTCAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-300s21c1
Sequence:CCGGACTCCCTGCACTGCTACTTTGCTCGAGCAAAGTAGCAGTGCAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-736s21c1
Sequence:CCGGTTGCTGTGTGGCTGCTTATATCTCGAGATATAAGCAGCCACACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-1006s21c1
Sequence:CCGGGGTGTCAGAGAGTAAGCTATACTCGAGTATAGCTTACTCTCTGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-534s21c1
Sequence:CCGGCCCTCATTGACCAGTACTTAACTCGAGTTAAGTACTGGTCAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133240
VALIDATED
ACOT8 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-833s1c1
Sequence:CCGGGATCACTCCATGTGGTTTCATCTCGAGATGAAACCACATGGAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-271s1c1
Sequence:CCGGCAAGTCTGTGAGTGAAGACGTCTCGAGACGTCTTCACTCACAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-561s21c1
Sequence:CCGGCTAACCTTCACAAGAAGTATCCTCGAGGATACTTCTTGTGAAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-1006s1c1
Sequence:CCGGGGTGTCAGAGAGTAAGCTATACTCGAGTATAGCTTACTCTCTGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-534s1c1
Sequence:CCGGCCCTCATTGACCAGTACTTAACTCGAGTTAAGTACTGGTCAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-300s21c1
Sequence:CCGGACTCCCTGCACTGCTACTTTGCTCGAGCAAAGTAGCAGTGCAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-736s21c1
Sequence:CCGGTTGCTGTGTGGCTGCTTATATCTCGAGATATAAGCAGCCACACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-1006s21c1
Sequence:CCGGGGTGTCAGAGAGTAAGCTATACTCGAGTATAGCTTACTCTCTGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-534s21c1
Sequence:CCGGCCCTCATTGACCAGTACTTAACTCGAGTTAAGTACTGGTCAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133240
VALIDATED
ACOT8 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-833s1c1
Sequence:CCGGGATCACTCCATGTGGTTTCATCTCGAGATGAAACCACATGGAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-271s1c1
Sequence:CCGGCAAGTCTGTGAGTGAAGACGTCTCGAGACGTCTTCACTCACAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-561s21c1
Sequence:CCGGCTAACCTTCACAAGAAGTATCCTCGAGGATACTTCTTGTGAAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-1006s1c1
Sequence:CCGGGGTGTCAGAGAGTAAGCTATACTCGAGTATAGCTTACTCTCTGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133240.1-534s1c1
Sequence:CCGGCCCTCATTGACCAGTACTTAACTCGAGTTAAGTACTGGTCAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-300s21c1
Sequence:CCGGACTCCCTGCACTGCTACTTTGCTCGAGCAAAGTAGCAGTGCAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-736s21c1
Sequence:CCGGTTGCTGTGTGGCTGCTTATATCTCGAGATATAAGCAGCCACACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-1006s21c1
Sequence:CCGGGGTGTCAGAGAGTAAGCTATACTCGAGTATAGCTTACTCTCTGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_133240.1-534s21c1
Sequence:CCGGCCCTCATTGACCAGTACTTAACTCGAGTTAAGTACTGGTCAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks