EMAIL THIS PAGE TO A FRIEND

ACOX1

acyl-CoA oxidase 1, palmitoyl

106 Gene Product Result for
Synonyms: ACOX PALMCOX SCOX
Gene ID:
Human(51) Summary: The protein encoded by this gene is the first enzyme of the fatty acid beta-oxidation pathway, which catalyzes the desaturation of acyl-CoAs to 2-trans-enoyl-CoAs. It donates electrons directly to molecular oxygen, thereby producing hydrogen peroxide. Defects in this gene result in pseudoneonatal adrenoleukodystrophy, a disease that is characterized by accumulation of very long chain fatty acids. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(11430) acyl-Coenzyme A oxidase 1, palmitoyl
Rat(50681) acyl-CoA oxidase 1, palmitoyl
Zebrafish(449662) acyl-Coenzyme A oxidase 1, palmitoyl
dog(483322) acyl-CoA oxidase 1, palmitoyl
domestic cat(101082279) acyl-CoA oxidase 1, palmitoyl
Horse(100051466) acyl-CoA oxidase 1, palmitoyl
cow(513996) acyl-CoA oxidase 1, palmitoyl
chicken(417366) acyl-CoA oxidase 1, palmitoyl
sheep(101118626) acyl-CoA oxidase 1, palmitoyl
Domestic Rabbit(100338450) acyl-CoA oxidase 1, palmitoyl
domestic guinea pig(100135467) acyl-Coenzyme A oxidase 1, palmitoyl
naked mole-rat(101705097) acyl-CoA oxidase 1, palmitoyl
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004035 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004035 Rosetta Predictions human pricing
NM_007292 Rosetta Predictions human pricing
NM_017340 Rosetta Predictions rat pricing
NM_015729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227179 predicted 1700
2 SASI_Hs01_00227180 predicted 1304
3 SASI_Hs01_00227181 predicted 1972
4 SASI_Hs01_00227182 predicted 2039
5 SASI_Hs01_00227183 predicted 974
6 SASI_Hs01_00227184 predicted 2051
7 SASI_Hs01_00227185 predicted 1967
8 SASI_Hs02_00336781 predicted 940
9 SASI_Hs01_00227186 predicted 1835
10 SASI_Hs01_00227187 predicted 1956
11 SASI_Hs01_00227188 predicted 1765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090716 predicted 1703
2 SASI_Hs01_00090717 predicted 1308
3 SASI_Hs01_00090718 predicted 1977
4 SASI_Hs01_00090719 predicted 2048
5 SASI_Hs01_00090720 predicted 972
6 SASI_Hs01_00090721 predicted 2058
7 SASI_Hs01_00090722 predicted 1961
8 SASI_Hs02_00343362 predicted 937
9 SASI_Hs01_00090723 predicted 1833
10 SASI_Hs01_00090724 predicted 1954
11 SASI_Hs01_00090725 predicted 1762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068237 predicted 333
2 SASI_Rn01_00068238 predicted 512
3 SASI_Rn02_00261801 predicted 519
4 SASI_Rn01_00068239 predicted 1495
5 SASI_Rn01_00068240 predicted 686
6 SASI_Rn01_00068242 predicted 973
7 SASI_Rn01_00068243 predicted 592
8 SASI_Rn02_00261802 predicted 877
9 SASI_Rn01_00068244 predicted 773
10 SASI_Rn02_00261803 predicted 1123
11 SASI_Rn01_00068241 predicted 2096
12 SASI_Rn01_00068245 predicted 1128
13 SASI_Rn01_00068246 predicted 1943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153538 predicted 2207
2 SASI_Mm01_00153540 predicted 1683
3 SASI_Mm01_00153541 predicted 2369
4 SASI_Mm01_00153542 predicted 2399
5 SASI_Mm01_00153545 predicted 768
6 SASI_Mm01_00153546 predicted 1030
7 SASI_Mm01_00153547 predicted 936
8 SASI_Mm02_00323051 predicted 2206
9 SASI_Mm02_00323052 predicted 442
10 SASI_Mm02_00323053 predicted 1024
11 SASI_Mm01_00153539 predicted 2369
12 SASI_Mm01_00153543 predicted 474
13 SASI_Mm01_00153544 predicted 1069
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004035
VALIDATED
ACOX1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA oxidase 1, palmitoyl
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-1711s1c1
Sequence:CCGGCGAAAGCCTAACCGAAGCATACTCGAGTATGCTTCGGTTAGGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-2212s1c1
Sequence:CCGGCGAATCTTACAAGCACCTGAACTCGAGTTCAGGTGCTTGTAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-1742s1c1
Sequence:CCGGGCAGCCAGATTAGTAGAAATTCTCGAGAATTTCTACTAATCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-1074s1c1
Sequence:CCGGCGCTGAGTAACAAGCTGACTTCTCGAGAAGTCAGCTTGTTACTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_004035.4-650s1c1
Sequence:CCGGGCCTGGAACTTGGAGATCATTCTCGAGAATGATCTCCAAGTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-1337s21c1
Sequence:CCGGGGAGACCTATCACCGGATTAACTCGAGTTAATCCGGTGATAGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004035.5-2578s21c1
Sequence:CCGGACTACTGAGTAGTTGATTATTCTCGAGAATAATCAACTACTCAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-1499s21c1
Sequence:CCGGTTGCAGTGGTCTTCCAAATATCTCGAGATATTTGGAAGACCACTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-2048s21c1
Sequence:CCGGACAAGTAAACCAGCGTGTAAACTCGAGTTTACACGCTGGTTTACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-525s21c1
Sequence:CCGGATCGCTGACCCTGATGAAATTCTCGAGAATTTCATCAGGGTCAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-918s21c1
Sequence:CCGGCGTGAAATCGGGACCCATAAGCTCGAGCTTATGGGTCCCGATTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-1881s21c1
Sequence:CCGGTGCCACTATGTGGTAGTTAAGCTCGAGCTTAACTACCACATAGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004035.5-2309s21c1
Sequence:CCGGGCGCCTGTGTGCAACTCAAATCTCGAGATTTGAGTTGCACACAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004035
VALIDATED
ACOX1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA oxidase 1, palmitoyl
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-1711s1c1
Sequence:CCGGCGAAAGCCTAACCGAAGCATACTCGAGTATGCTTCGGTTAGGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-2212s1c1
Sequence:CCGGCGAATCTTACAAGCACCTGAACTCGAGTTCAGGTGCTTGTAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-1742s1c1
Sequence:CCGGGCAGCCAGATTAGTAGAAATTCTCGAGAATTTCTACTAATCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-1074s1c1
Sequence:CCGGCGCTGAGTAACAAGCTGACTTCTCGAGAAGTCAGCTTGTTACTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_004035.4-650s1c1
Sequence:CCGGGCCTGGAACTTGGAGATCATTCTCGAGAATGATCTCCAAGTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-1337s21c1
Sequence:CCGGGGAGACCTATCACCGGATTAACTCGAGTTAATCCGGTGATAGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004035.5-2578s21c1
Sequence:CCGGACTACTGAGTAGTTGATTATTCTCGAGAATAATCAACTACTCAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-1499s21c1
Sequence:CCGGTTGCAGTGGTCTTCCAAATATCTCGAGATATTTGGAAGACCACTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-2048s21c1
Sequence:CCGGACAAGTAAACCAGCGTGTAAACTCGAGTTTACACGCTGGTTTACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-525s21c1
Sequence:CCGGATCGCTGACCCTGATGAAATTCTCGAGAATTTCATCAGGGTCAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-918s21c1
Sequence:CCGGCGTGAAATCGGGACCCATAAGCTCGAGCTTATGGGTCCCGATTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-1881s21c1
Sequence:CCGGTGCCACTATGTGGTAGTTAAGCTCGAGCTTAACTACCACATAGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004035.5-2309s21c1
Sequence:CCGGGCGCCTGTGTGCAACTCAAATCTCGAGATTTGAGTTGCACACAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004035
VALIDATED
ACOX1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA oxidase 1, palmitoyl
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-1711s1c1
Sequence:CCGGCGAAAGCCTAACCGAAGCATACTCGAGTATGCTTCGGTTAGGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-2212s1c1
Sequence:CCGGCGAATCTTACAAGCACCTGAACTCGAGTTCAGGTGCTTGTAAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-1742s1c1
Sequence:CCGGGCAGCCAGATTAGTAGAAATTCTCGAGAATTTCTACTAATCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004035.4-1074s1c1
Sequence:CCGGCGCTGAGTAACAAGCTGACTTCTCGAGAAGTCAGCTTGTTACTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_004035.4-650s1c1
Sequence:CCGGGCCTGGAACTTGGAGATCATTCTCGAGAATGATCTCCAAGTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-1337s21c1
Sequence:CCGGGGAGACCTATCACCGGATTAACTCGAGTTAATCCGGTGATAGGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004035.5-2578s21c1
Sequence:CCGGACTACTGAGTAGTTGATTATTCTCGAGAATAATCAACTACTCAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-1499s21c1
Sequence:CCGGTTGCAGTGGTCTTCCAAATATCTCGAGATATTTGGAAGACCACTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-2048s21c1
Sequence:CCGGACAAGTAAACCAGCGTGTAAACTCGAGTTTACACGCTGGTTTACTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-525s21c1
Sequence:CCGGATCGCTGACCCTGATGAAATTCTCGAGAATTTCATCAGGGTCAGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-918s21c1
Sequence:CCGGCGTGAAATCGGGACCCATAAGCTCGAGCTTATGGGTCCCGATTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004035.5-1881s21c1
Sequence:CCGGTGCCACTATGTGGTAGTTAAGCTCGAGCTTAACTACCACATAGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004035.5-2309s21c1
Sequence:CCGGGCGCCTGTGTGCAACTCAAATCTCGAGATTTGAGTTGCACACAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015729
ACOX1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA oxidase 1, palmitoyl
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-115s1c1
Sequence:CCGGCCACCTTCAATCCAGAGTTAACTCGAGTTAACTCTGGATTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-1551s1c1
Sequence:CCGGGCAGCCAGATTGGTAGAAATTCTCGAGAATTTCTACCAATCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-1099s1c1
Sequence:CCGGCCTTCCACTTTCTCGGAAGATCTCGAGATCTTCCGAGAAAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-324s1c1
Sequence:CCGGCCTGAAGAAATCATGTGGTTTCTCGAGAAACCACATGATTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-2021s1c1
Sequence:CCGGCCAATCTTACTACAAGCACTTCTCGAGAAGTGCTTGTAGTAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015729
ACOX1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA oxidase 1, palmitoyl
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-115s1c1
Sequence:CCGGCCACCTTCAATCCAGAGTTAACTCGAGTTAACTCTGGATTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-1551s1c1
Sequence:CCGGGCAGCCAGATTGGTAGAAATTCTCGAGAATTTCTACCAATCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-1099s1c1
Sequence:CCGGCCTTCCACTTTCTCGGAAGATCTCGAGATCTTCCGAGAAAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-324s1c1
Sequence:CCGGCCTGAAGAAATCATGTGGTTTCTCGAGAAACCACATGATTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-2021s1c1
Sequence:CCGGCCAATCTTACTACAAGCACTTCTCGAGAAGTGCTTGTAGTAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015729
ACOX1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA oxidase 1, palmitoyl
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-115s1c1
Sequence:CCGGCCACCTTCAATCCAGAGTTAACTCGAGTTAACTCTGGATTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-1551s1c1
Sequence:CCGGGCAGCCAGATTGGTAGAAATTCTCGAGAATTTCTACCAATCTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-1099s1c1
Sequence:CCGGCCTTCCACTTTCTCGGAAGATCTCGAGATCTTCCGAGAAAGTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-324s1c1
Sequence:CCGGCCTGAAGAAATCATGTGGTTTCTCGAGAAACCACATGATTTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015729.1-2021s1c1
Sequence:CCGGCCAATCTTACTACAAGCACTTCTCGAGAAGTGCTTGTAGTAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks