EMAIL THIS PAGE TO A FRIEND

ACOX2

acyl-CoA oxidase 2, branched chain

56 Gene Product Result for
Synonyms: BCOX BRCACOX BRCOX THCCox
UniProtKB ID: Q99424, A6NF16, B2R8U5
Gene ID:
Human(8309) Summary: The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is involved in the degradation of long branched fatty acids and bile acid intermediates in peroxisomes. Deficiency of this enzyme results in the accumulation of branched fatty acids and bile acid intermediates, and may lead to Zellweger syndrome, severe mental retardation, and death in children. [provided by RefSeq, Mar 2009]
Mouse(93732) acyl-Coenzyme A oxidase 2, branched chain
Rat(252898) acyl-CoA oxidase 2, branched chain
naked mole-rat(101716015) acyl-CoA oxidase 2, branched chain
domestic guinea pig(100730978) acyl-CoA oxidase 2, branched chain
sheep(101121460) acyl-CoA oxidase 2, branched chain
Domestic Rabbit(100009549) acyl-CoA oxidase 2, branched chain
chicken(416068) acyl-CoA oxidase 2, branched chain
dog(484710) acyl-CoA oxidase 2, branched chain
Horse(100050425) acyl-CoA oxidase 2, branched chain
cow(514969) acyl-CoA oxidase 2, branched chain
domestic cat(101101039) acyl-CoA oxidase 2, branched chain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003500 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041521 MISSION® esiRNA esiRNA human ACOX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003500 Rosetta Predictions human pricing
NM_145770 Rosetta Predictions rat pricing
NM_053115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335778 predicted 890
2 SASI_Hs01_00020601 predicted 1099
3 SASI_Hs01_00020602 predicted 1800
4 SASI_Hs01_00020603 predicted 458
5 SASI_Hs01_00020604 predicted 233
6 SASI_Hs01_00020605 predicted 331
7 SASI_Hs01_00020606 predicted 215
8 SASI_Hs01_00020608 predicted 1019
9 SASI_Hs01_00020609 predicted 1080
10 SASI_Hs01_00020610 predicted 599
11 SASI_Hs01_00020607 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070857 predicted 365
2 SASI_Rn01_00070858 predicted 584
3 SASI_Rn01_00070859 predicted 1931
4 SASI_Rn01_00070861 predicted 352
5 SASI_Rn02_00268763 predicted 371
6 SASI_Rn01_00070862 predicted 690
7 SASI_Rn01_00070863 predicted 1495
8 SASI_Rn01_00070864 predicted 546
9 SASI_Rn01_00070865 predicted 1705
10 SASI_Rn02_00268764 predicted 1588
11 SASI_Rn01_00070860 predicted 1751
12 SASI_Rn01_00070866 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177965 predicted 579
2 SASI_Mm01_00177966 predicted 537
3 SASI_Mm01_00177967 predicted 1919
4 SASI_Mm02_00337623 predicted 1140
5 SASI_Mm01_00177968 predicted 2178
6 SASI_Mm01_00177969 predicted 1486
7 SASI_Mm01_00177970 predicted 305
8 SASI_Mm01_00177971 predicted 1796
9 SASI_Mm01_00177972 predicted 2104
10 SASI_Mm01_00177973 predicted 367
11 SASI_Mm01_00177974 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053115
ACOX2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA oxidase 2, branched chain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053115.1-2338s1c1
Sequence:CCGGGCGAGTAAACTGGTACATGAACTCGAGTTCATGTACCAGTTTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-1712s1c1
Sequence:CCGGCCAGGCTCATAAGAGATGCAACTCGAGTTGCATCTCTTATGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-2179s1c1
Sequence:CCGGCCTGCCTATAAGAAGTATATTCTCGAGAATATACTTCTTATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-370s1c1
Sequence:CCGGCCAGTGTTTAATTTGAAGCATCTCGAGATGCTTCAAATTAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-2177s1c1
Sequence:CCGGACCCTGCCTATAAGAAGTATACTCGAGTATACTTCTTATAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053115
ACOX2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA oxidase 2, branched chain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053115.1-2338s1c1
Sequence:CCGGGCGAGTAAACTGGTACATGAACTCGAGTTCATGTACCAGTTTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-1712s1c1
Sequence:CCGGCCAGGCTCATAAGAGATGCAACTCGAGTTGCATCTCTTATGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-2179s1c1
Sequence:CCGGCCTGCCTATAAGAAGTATATTCTCGAGAATATACTTCTTATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-370s1c1
Sequence:CCGGCCAGTGTTTAATTTGAAGCATCTCGAGATGCTTCAAATTAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-2177s1c1
Sequence:CCGGACCCTGCCTATAAGAAGTATACTCGAGTATACTTCTTATAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053115
ACOX2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA oxidase 2, branched chain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053115.1-2338s1c1
Sequence:CCGGGCGAGTAAACTGGTACATGAACTCGAGTTCATGTACCAGTTTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-1712s1c1
Sequence:CCGGCCAGGCTCATAAGAGATGCAACTCGAGTTGCATCTCTTATGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-2179s1c1
Sequence:CCGGCCTGCCTATAAGAAGTATATTCTCGAGAATATACTTCTTATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-370s1c1
Sequence:CCGGCCAGTGTTTAATTTGAAGCATCTCGAGATGCTTCAAATTAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053115.1-2177s1c1
Sequence:CCGGACCCTGCCTATAAGAAGTATACTCGAGTATACTTCTTATAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003500
ACOX2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA oxidase 2, branched chain
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-1146s1c1
Sequence:CCGGGCCATCAGTTATGCCTTCCATCTCGAGATGGAAGGCATAACTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-164s1c1
Sequence:CCGGCGAGAGGTATATGCAGTCCTTCTCGAGAAGGACTGCATATACCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-2049s1c1
Sequence:CCGGGCTCAGAAGTCACCAACCAATCTCGAGATTGGTTGGTGACTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-1826s1c1
Sequence:CCGGCCATGCCATACATGGAATCTTCTCGAGAAGATTCCATGTATGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-342s1c1
Sequence:CCGGGCATTCCACATCCGGTTGATACTCGAGTATCAACCGGATGTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003500
ACOX2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA oxidase 2, branched chain
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-1146s1c1
Sequence:CCGGGCCATCAGTTATGCCTTCCATCTCGAGATGGAAGGCATAACTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-164s1c1
Sequence:CCGGCGAGAGGTATATGCAGTCCTTCTCGAGAAGGACTGCATATACCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-2049s1c1
Sequence:CCGGGCTCAGAAGTCACCAACCAATCTCGAGATTGGTTGGTGACTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-1826s1c1
Sequence:CCGGCCATGCCATACATGGAATCTTCTCGAGAAGATTCCATGTATGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-342s1c1
Sequence:CCGGGCATTCCACATCCGGTTGATACTCGAGTATCAACCGGATGTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003500
ACOX2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA oxidase 2, branched chain
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-1146s1c1
Sequence:CCGGGCCATCAGTTATGCCTTCCATCTCGAGATGGAAGGCATAACTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-164s1c1
Sequence:CCGGCGAGAGGTATATGCAGTCCTTCTCGAGAAGGACTGCATATACCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-2049s1c1
Sequence:CCGGGCTCAGAAGTCACCAACCAATCTCGAGATTGGTTGGTGACTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-1826s1c1
Sequence:CCGGCCATGCCATACATGGAATCTTCTCGAGAAGATTCCATGTATGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003500.1-342s1c1
Sequence:CCGGGCATTCCACATCCGGTTGATACTCGAGTATCAACCGGATGTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks