EMAIL THIS PAGE TO A FRIEND

ACOX3

acyl-CoA oxidase 3, pristanoyl

62 Gene Product Result for
UniProtKB ID: O15254, Q96AJ8
Gene ID:
Human(8310) Summary: Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. Unlike the rat homolog, the human gene is expressed in very low amounts in liver such that its mRNA was undetectable by routine Northern-blot analysis or its product by immunoblotting or by enzyme activity measurements. However the human cDNA encoding a 700 amino acid protein with a peroxisomal targeting C-terminal tripeptide S-K-L was isolated and is thought to be expressed under special conditions such as specific developmental stages or in a tissue specific manner in tissues that have not yet been examined. [provided by RefSeq, Jul 2008]
Mouse(80911) acyl-Coenzyme A oxidase 3, pristanoyl
Rat(83522) acyl-CoA oxidase 3, pristanoyl
Zebrafish(406421) acyl-Coenzyme A oxidase 3, pristanoyl
cow(510065) acyl-CoA oxidase 3, pristanoyl
Horse(100056690) acyl-CoA oxidase 3, pristanoyl
domestic cat(101088745) acyl-CoA oxidase 3, pristanoyl
dog(488790) acyl-CoA oxidase 3, pristanoyl
chicken(422869) acyl-CoA oxidase 3, pristanoyl
sheep(101119642) acyl-CoA oxidase 3, pristanoyl
domestic guinea pig(100716952) acyl-CoA oxidase 3, pristanoyl
naked mole-rat(101719939) acyl-CoA oxidase 3, pristanoyl
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003501 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101667 Rosetta Predictions human pricing
NM_003501 Rosetta Predictions human pricing
NM_053339 Rosetta Predictions rat pricing
NM_030721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322901 predicted 566
2 SASI_Hs02_00322902 predicted 502
3 SASI_Hs02_00322903 predicted 1169
4 SASI_Hs02_00322904 predicted 1467
5 SASI_Hs02_00322905 predicted 1635
6 SASI_Hs02_00322906 predicted 1434
7 SASI_Hs02_00322907 predicted 1384
8 SASI_Hs02_00322908 predicted 1109
9 SASI_Hs02_00322909 predicted 334
10 SASI_Hs02_00322910 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090469 predicted 564
2 SASI_Hs01_00090471 predicted 2203
3 SASI_Hs02_00335779 predicted 1167
4 SASI_Hs01_00090473 predicted 1475
5 SASI_Hs02_00335780 predicted 2275
6 SASI_Hs01_00090474 predicted 1636
7 SASI_Hs01_00090475 predicted 1431
8 SASI_Hs01_00090476 predicted 1383
9 SASI_Hs01_00090477 predicted 1118
10 SASI_Hs02_00335781 predicted 1548
11 SASI_Hs01_00090470 predicted 487
12 SASI_Hs01_00090472 predicted 1156
13 SASI_Hs01_00090478 predicted 2167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112961 predicted 2220
2 SASI_Rn01_00112962 predicted 338
3 SASI_Rn01_00112963 predicted 595
4 SASI_Rn01_00112964 predicted 1335
5 SASI_Rn01_00112965 predicted 1672
6 SASI_Rn01_00112966 predicted 997
7 SASI_Rn01_00112967 predicted 802
8 SASI_Rn01_00112968 predicted 1359
9 SASI_Rn01_00112969 predicted 1475
10 SASI_Rn01_00112970 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082899 predicted 742
2 SASI_Mm01_00082900 predicted 2262
3 SASI_Mm01_00082901 predicted 1290
4 SASI_Mm01_00082902 predicted 1483
5 SASI_Mm01_00082903 predicted 1565
6 SASI_Mm01_00082904 predicted 948
7 SASI_Mm01_00082905 predicted 1529
8 SASI_Mm01_00082906 predicted 538
9 SASI_Mm01_00082908 predicted 658
10 SASI_Mm02_00336908 predicted 620
11 SASI_Mm01_00082907 predicted 718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003501
ACOX3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA oxidase 3, pristanoyl
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-1444s1c1
Sequence:CCGGGCAGCAGACAAGCAACTATTTCTCGAGAAATAGTTGCTTGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-1171s1c1
Sequence:CCGGCCATTTCTCCAAGTCGCTCTTCTCGAGAAGAGCGACTTGGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-272s1c1
Sequence:CCGGGACCTGTCCTTGGAGAAGTATCTCGAGATACTTCTCCAAGGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-2141s1c1
Sequence:CCGGCCTGTCATAGGAAGTCTGAAACTCGAGTTTCAGACTTCCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-559s1c1
Sequence:CCGGCGGCAGTAATACCAAGGCCATCTCGAGATGGCCTTGGTATTACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003501.2-2464s21c1
Sequence:CCGGTAATTAGAATTTCGCACATTCCTCGAGGAATGTGCGAAATTCTAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003501.2-337s21c1
Sequence:CCGAGCAAGCGGATCTTCGAGTATGCTCGAGCATACTCGAAGATCCGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003501.2-2385s21c1
Sequence:CCGGATCTGGGATCGCGGTGATTTGCTCGAGCAAATCACCGCGATCCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003501
ACOX3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA oxidase 3, pristanoyl
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-1444s1c1
Sequence:CCGGGCAGCAGACAAGCAACTATTTCTCGAGAAATAGTTGCTTGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-1171s1c1
Sequence:CCGGCCATTTCTCCAAGTCGCTCTTCTCGAGAAGAGCGACTTGGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-272s1c1
Sequence:CCGGGACCTGTCCTTGGAGAAGTATCTCGAGATACTTCTCCAAGGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-2141s1c1
Sequence:CCGGCCTGTCATAGGAAGTCTGAAACTCGAGTTTCAGACTTCCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-559s1c1
Sequence:CCGGCGGCAGTAATACCAAGGCCATCTCGAGATGGCCTTGGTATTACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003501.2-2464s21c1
Sequence:CCGGTAATTAGAATTTCGCACATTCCTCGAGGAATGTGCGAAATTCTAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003501.2-337s21c1
Sequence:CCGAGCAAGCGGATCTTCGAGTATGCTCGAGCATACTCGAAGATCCGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003501.2-2385s21c1
Sequence:CCGGATCTGGGATCGCGGTGATTTGCTCGAGCAAATCACCGCGATCCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003501
ACOX3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA oxidase 3, pristanoyl
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-1444s1c1
Sequence:CCGGGCAGCAGACAAGCAACTATTTCTCGAGAAATAGTTGCTTGTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-1171s1c1
Sequence:CCGGCCATTTCTCCAAGTCGCTCTTCTCGAGAAGAGCGACTTGGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-272s1c1
Sequence:CCGGGACCTGTCCTTGGAGAAGTATCTCGAGATACTTCTCCAAGGACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-2141s1c1
Sequence:CCGGCCTGTCATAGGAAGTCTGAAACTCGAGTTTCAGACTTCCTATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003501.1-559s1c1
Sequence:CCGGCGGCAGTAATACCAAGGCCATCTCGAGATGGCCTTGGTATTACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003501.2-2464s21c1
Sequence:CCGGTAATTAGAATTTCGCACATTCCTCGAGGAATGTGCGAAATTCTAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003501.2-337s21c1
Sequence:CCGAGCAAGCGGATCTTCGAGTATGCTCGAGCATACTCGAAGATCCGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003501.2-2385s21c1
Sequence:CCGGATCTGGGATCGCGGTGATTTGCTCGAGCAAATCACCGCGATCCCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030721
ACOX3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA oxidase 3, pristanoyl
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030721.2-3306s1c1
Sequence:CCGGCCACCTATTTATCTGACCATACTCGAGTATGGTCAGATAAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-1287s1c1
Sequence:CCGGCCACTTCTCTAAGACAATCTTCTCGAGAAGATTGTCTTAGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-1777s1c1
Sequence:CCGGCGGAGATACTGCCAAGAGAAACTCGAGTTTCTCTTGGCAGTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-309s1c1
Sequence:CCGGCCAGGATGTAATCCACTTCAACTCGAGTTGAAGTGGATTACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030721.2-695s21c1
Sequence:CCGGTGCGAACGACAGCTCACTATGCTCGAGCATAGTGAGCTGTCGTTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030721.2-2704s21c1
Sequence:CCGGACCATCAGAATGATGTAATTTCTCGAGAAATTACATCATTCTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030721.2-2158s21c1
Sequence:CCGGGCTGATGGTGAGCTCTATAAACTCGAGTTTATAGAGCTCACCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-2237s1c2
Sequence:CCGGCCGAGTTCTCTGCCAACAAATCTCGAGATTTGTTGGCAGAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030721
ACOX3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA oxidase 3, pristanoyl
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030721.2-3306s1c1
Sequence:CCGGCCACCTATTTATCTGACCATACTCGAGTATGGTCAGATAAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-1287s1c1
Sequence:CCGGCCACTTCTCTAAGACAATCTTCTCGAGAAGATTGTCTTAGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-1777s1c1
Sequence:CCGGCGGAGATACTGCCAAGAGAAACTCGAGTTTCTCTTGGCAGTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-309s1c1
Sequence:CCGGCCAGGATGTAATCCACTTCAACTCGAGTTGAAGTGGATTACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030721.2-695s21c1
Sequence:CCGGTGCGAACGACAGCTCACTATGCTCGAGCATAGTGAGCTGTCGTTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030721.2-2704s21c1
Sequence:CCGGACCATCAGAATGATGTAATTTCTCGAGAAATTACATCATTCTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030721.2-2158s21c1
Sequence:CCGGGCTGATGGTGAGCTCTATAAACTCGAGTTTATAGAGCTCACCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-2237s1c2
Sequence:CCGGCCGAGTTCTCTGCCAACAAATCTCGAGATTTGTTGGCAGAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030721
ACOX3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA oxidase 3, pristanoyl
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030721.2-3306s1c1
Sequence:CCGGCCACCTATTTATCTGACCATACTCGAGTATGGTCAGATAAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-1287s1c1
Sequence:CCGGCCACTTCTCTAAGACAATCTTCTCGAGAAGATTGTCTTAGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-1777s1c1
Sequence:CCGGCGGAGATACTGCCAAGAGAAACTCGAGTTTCTCTTGGCAGTATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-309s1c1
Sequence:CCGGCCAGGATGTAATCCACTTCAACTCGAGTTGAAGTGGATTACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030721.2-695s21c1
Sequence:CCGGTGCGAACGACAGCTCACTATGCTCGAGCATAGTGAGCTGTCGTTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030721.2-2704s21c1
Sequence:CCGGACCATCAGAATGATGTAATTTCTCGAGAAATTACATCATTCTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030721.2-2158s21c1
Sequence:CCGGGCTGATGGTGAGCTCTATAAACTCGAGTTTATAGAGCTCACCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030721.2-2237s1c2
Sequence:CCGGCCGAGTTCTCTGCCAACAAATCTCGAGATTTGTTGGCAGAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks