EMAIL THIS PAGE TO A FRIEND

ACOXL

acyl-CoA oxidase-like

71 Gene Product Result for
Gene ID:
Mouse(74121) acyl-Coenzyme A oxidase-like
Rat(296138) acyl-CoA oxidase-like
Zebrafish(569104) acyl-Coenzyme A oxidase-like
cow(617774) acyl-CoA oxidase-like
cow(100336467) acyl-CoA oxidase-like
Horse(100064086) acyl-CoA oxidase-like
domestic cat(101088661) acyl-CoA oxidase-like
dog(611729) acyl-CoA oxidase-like
naked mole-rat(101715547) acyl-CoA oxidase-like
sheep(101118010) acyl-CoA oxidase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001142807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001142807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001142807 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018308 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105516 Rosetta Predictions human pricing
NM_018308 Rosetta Predictions human pricing
NM_001106508 Rosetta Predictions rat pricing
NM_028765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324144 predicted 552
2 SASI_Hs02_00324145 predicted 1510
3 SASI_Hs02_00324146 predicted 316
4 SASI_Hs02_00324147 predicted 1518
5 SASI_Hs02_00324148 predicted 1332
6 SASI_Hs02_00324149 predicted 1263
7 SASI_Hs02_00324150 predicted 1617
8 SASI_Hs02_00324151 predicted 724
9 SASI_Hs02_00324152 predicted 1464
10 SASI_Hs02_00324153 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020950 predicted 865
2 SASI_Hs01_00020951 predicted 678
3 SASI_Hs01_00020952 predicted 259
4 SASI_Hs01_00020953 predicted 598
5 SASI_Hs01_00020954 predicted 876
6 SASI_Hs01_00020955 predicted 694
7 SASI_Hs01_00020956 predicted 620
8 SASI_Hs01_00020957 predicted 617
9 SASI_Hs01_00020958 predicted 975
10 SASI_Hs01_00020959 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219658 predicted 1650
2 SASI_Rn02_00219659 predicted 1000
3 SASI_Rn02_00219660 predicted 1864
4 SASI_Rn02_00219661 predicted 656
5 SASI_Rn02_00219662 predicted 1041
6 SASI_Rn02_00219663 predicted 866
7 SASI_Rn02_00219664 predicted 1844
8 SASI_Rn02_00219665 predicted 1023
9 SASI_Rn02_00219666 predicted 1272
10 SASI_Rn02_00219667 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191323 predicted 1407
2 SASI_Mm01_00191324 predicted 529
3 SASI_Mm01_00191325 predicted 1252
4 SASI_Mm01_00191326 predicted 657
5 SASI_Mm01_00191327 predicted 651
6 SASI_Mm01_00191329 predicted 1035
7 SASI_Mm02_00334361 predicted 1368
8 SASI_Mm01_00191330 predicted 826
9 SASI_Mm01_00191331 predicted 607
10 SASI_Mm01_00191332 predicted 987
11 SASI_Mm01_00191328 predicted 1631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142807
ACOXL MISSION shRNA Bacterial Glycerol Stock
acyl-CoA oxidase-like
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000435087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142807.1-829s21c1
Sequence:CCGGAGAACCTGCTGGATAAGTTTGCTCGAGCAAACTTATCCAGCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142807.1-374s21c1
Sequence:CCGGAGGAGTGAAGTGCGGAATAATCTCGAGATTATTCCGCACTTCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142807
ACOXL MISSION shRNA shRNA Plasmid DNA
acyl-CoA oxidase-like
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000435087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142807.1-829s21c1
Sequence:CCGGAGAACCTGCTGGATAAGTTTGCTCGAGCAAACTTATCCAGCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142807.1-374s21c1
Sequence:CCGGAGGAGTGAAGTGCGGAATAATCTCGAGATTATTCCGCACTTCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142807
ACOXL MISSION shRNA Lentiviral Transduction Particles
acyl-CoA oxidase-like
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000435087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142807.1-829s21c1
Sequence:CCGGAGAACCTGCTGGATAAGTTTGCTCGAGCAAACTTATCCAGCAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142807.1-374s21c1
Sequence:CCGGAGGAGTGAAGTGCGGAATAATCTCGAGATTATTCCGCACTTCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028765
ACOXL MISSION shRNA Bacterial Glycerol Stock
acyl-CoA oxidase-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-433s1c1
Sequence:CCGGCATGTCTATAAAGTGTGGAATCTCGAGATTCCACACTTTATAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028765.1-2113s1c1
Sequence:CCGGGCGAGAAATTTAGTGTCCCATCTCGAGATGGGACACTAAATTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-1860s1c1
Sequence:CCGGGCTGGTACTTAGAACATAAATCTCGAGATTTATGTTCTAAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-718s1c1
Sequence:CCGGCCAACTCATCATTGAGGGAAACTCGAGTTTCCCTCAATGATGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-1110s1c1
Sequence:CCGGTGAAGATCATTGAGCACCAAACTCGAGTTTGGTGCTCAATGATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028765
ACOXL MISSION shRNA shRNA Plasmid DNA
acyl-CoA oxidase-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-433s1c1
Sequence:CCGGCATGTCTATAAAGTGTGGAATCTCGAGATTCCACACTTTATAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028765.1-2113s1c1
Sequence:CCGGGCGAGAAATTTAGTGTCCCATCTCGAGATGGGACACTAAATTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-1860s1c1
Sequence:CCGGGCTGGTACTTAGAACATAAATCTCGAGATTTATGTTCTAAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-718s1c1
Sequence:CCGGCCAACTCATCATTGAGGGAAACTCGAGTTTCCCTCAATGATGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-1110s1c1
Sequence:CCGGTGAAGATCATTGAGCACCAAACTCGAGTTTGGTGCTCAATGATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028765
ACOXL MISSION shRNA Lentiviral Transduction Particles
acyl-CoA oxidase-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-433s1c1
Sequence:CCGGCATGTCTATAAAGTGTGGAATCTCGAGATTCCACACTTTATAGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028765.1-2113s1c1
Sequence:CCGGGCGAGAAATTTAGTGTCCCATCTCGAGATGGGACACTAAATTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-1860s1c1
Sequence:CCGGGCTGGTACTTAGAACATAAATCTCGAGATTTATGTTCTAAGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-718s1c1
Sequence:CCGGCCAACTCATCATTGAGGGAAACTCGAGTTTCCCTCAATGATGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028765.1-1110s1c1
Sequence:CCGGTGAAGATCATTGAGCACCAAACTCGAGTTTGGTGCTCAATGATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018308
ACOXL MISSION shRNA Bacterial Glycerol Stock
acyl-CoA oxidase-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-1090s1c1
Sequence:CCGGGCCTGGTATTTAGAACATAAACTCGAGTTTATGTTCTAAATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-972s1c1
Sequence:CCGGCCGAGTTACCTTAGAGCAGTTCTCGAGAACTGCTCTAAGGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-784s1c1
Sequence:CCGGGCATTTAACATGGACACAGTTCTCGAGAACTGTGTCCATGTTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-168s1c1
Sequence:CCGGCCATTCGCCTATTAGGAACAACTCGAGTTGTTCCTAATAGGCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-688s1c1
Sequence:CCGGGCCCAATACACCAAACAGTATCTCGAGATACTGTTTGGTGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018308
ACOXL MISSION shRNA shRNA Plasmid DNA
acyl-CoA oxidase-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-1090s1c1
Sequence:CCGGGCCTGGTATTTAGAACATAAACTCGAGTTTATGTTCTAAATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-972s1c1
Sequence:CCGGCCGAGTTACCTTAGAGCAGTTCTCGAGAACTGCTCTAAGGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-784s1c1
Sequence:CCGGGCATTTAACATGGACACAGTTCTCGAGAACTGTGTCCATGTTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-168s1c1
Sequence:CCGGCCATTCGCCTATTAGGAACAACTCGAGTTGTTCCTAATAGGCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-688s1c1
Sequence:CCGGGCCCAATACACCAAACAGTATCTCGAGATACTGTTTGGTGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018308
ACOXL MISSION shRNA Lentiviral Transduction Particles
acyl-CoA oxidase-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-1090s1c1
Sequence:CCGGGCCTGGTATTTAGAACATAAACTCGAGTTTATGTTCTAAATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-972s1c1
Sequence:CCGGCCGAGTTACCTTAGAGCAGTTCTCGAGAACTGCTCTAAGGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-784s1c1
Sequence:CCGGGCATTTAACATGGACACAGTTCTCGAGAACTGTGTCCATGTTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-168s1c1
Sequence:CCGGCCATTCGCCTATTAGGAACAACTCGAGTTGTTCCTAATAGGCGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018308.1-688s1c1
Sequence:CCGGGCCCAATACACCAAACAGTATCTCGAGATACTGTTTGGTGTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks