EMAIL THIS PAGE TO A FRIEND

ACP1

acid phosphatase 1, soluble

Synonyms: HAAP
Gene ID:
Human(52) Summary: The product of this gene belongs to the phosphotyrosine protein phosphatase family of proteins. It functions as an acid phosphatase and a protein tyrosine phosphatase by hydrolyzing protein tyrosine phosphate to protein tyrosine and orthophosphate. This enzyme also hydrolyzes orthophosphoric monoesters to alcohol and orthophosphate. This gene is genetically polymorphic, and three common alleles segregating at the corresponding locus give rise to six phenotypes. Each allele appears to encode at least two electrophoretically different isozymes, Bf and Bs, which are produced in allele-specific ratios. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2008]
Mouse(11431) acid phosphatase 1, soluble
Rat(24161) acid phosphatase 1, soluble
Zebrafish(541489) acid phosphatase 1, soluble
Thale Cress(819664) acyl carrier protein 1
chicken(421909) acid phosphatase 1, soluble
fruit fly(34052) Adult cuticle protein 1
domestic cat(101092352) acid phosphatase 1, soluble
cow(280977) acid phosphatase 1, soluble
Horse(100057408) acid phosphatase 1, soluble
Goat(100861348) acid phosphatase 1, soluble
sheep(101119876) acid phosphatase 1, soluble
domestic guinea pig(100728674) acid phosphatase 1, soluble
naked mole-rat(101703015) acid phosphatase 1, soluble
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021330 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021330 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021330 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007099 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040649 Rosetta Predictions human pricing
NM_004300 siRNAs that have been validated in the lab human pricing
NM_007099 Rosetta Predictions human pricing
NM_021262 Rosetta Predictions rat pricing
NM_001110239 Rosetta Predictions mouse pricing
NM_021330 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061090 predicted 226
2 SASI_Hs01_00061091 predicted 333
3 SASI_Hs02_00309025 predicted 375
4 SASI_Hs02_00309026 predicted 378
5 SASI_Hs01_00061094 predicted 314
6 SASI_Hs01_00061095 predicted 199
7 SASI_Hs01_00061096 predicted 235
8 SASI_Hs01_00061098 predicted 313
9 SASI_Hs01_00061099 predicted 223
10 SASI_Hs02_00309027 predicted 322
11 SASI_Hs01_00061092 predicted 202
12 SASI_Hs01_00061093 predicted 222
13 SASI_Hs01_00061097 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004300 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080745 validated 1022
1 SASI_Hs01_00080747 validated 768
2 SASI_Hs01_00080746 predicted 853
3 SASI_Hs01_00080748 predicted 1019
4 SASI_Hs02_00337319 predicted 1019
5 SASI_Hs01_00080749 predicted 897
6 SASI_Hs01_00080750 predicted 873
7 SASI_Hs01_00080751 predicted 1004
8 SASI_Hs02_00337320 predicted 766
9 SASI_Hs01_00080752 predicted 859
10 SASI_Hs01_00080753 predicted 813
11 SASI_Hs01_00080754 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186043 predicted 1022
2 SASI_Hs01_00186044 predicted 850
3 SASI_Hs01_00186046 predicted 1012
4 SASI_Hs02_00342933 predicted 1024
5 SASI_Hs01_00186047 predicted 905
6 SASI_Hs01_00186048 predicted 871
7 SASI_Hs01_00186049 predicted 1013
8 SASI_Hs02_00342934 predicted 764
9 SASI_Hs01_00186050 predicted 860
10 SASI_Hs01_00186051 predicted 816
11 SASI_Hs01_00186045 predicted 767
12 SASI_Hs01_00186052 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058949 predicted 246
2 SASI_Rn01_00058950 predicted 611
3 SASI_Rn01_00058951 predicted 306
4 SASI_Rn01_00058952 predicted 781
5 SASI_Rn01_00058953 predicted 401
6 SASI_Rn01_00058954 predicted 405
7 SASI_Rn01_00058955 predicted 311
8 SASI_Rn01_00058957 predicted 843
9 SASI_Rn01_00058958 predicted 895
10 SASI_Rn02_00262571 predicted 635
11 SASI_Rn01_00058956 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305126 predicted 568
2 SASI_Mm02_00305127 predicted 546
3 SASI_Mm02_00305128 predicted 278
4 SASI_Mm02_00305129 predicted 693
5 SASI_Mm02_00305130 predicted 185
6 SASI_Mm02_00305131 predicted 267
7 SASI_Mm02_00305132 predicted 355
8 SASI_Mm02_00305133 predicted 459
9 SASI_Mm02_00305134 predicted 480
10 SASI_Mm02_00305135 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325906 predicted 570
2 SASI_Mm01_00137460 predicted 544
3 SASI_Mm01_00137463 predicted 693
4 SASI_Mm01_00137464 predicted 746
5 SASI_Mm01_00137465 predicted 727
6 SASI_Mm01_00137461 predicted 358
7 SASI_Mm01_00137462 predicted 459
8 SASI_Mm02_00325907 predicted 480
9 SASI_Mm01_00137467 predicted 566
10 SASI_Mm01_00137468 predicted 194
11 SASI_Mm01_00137459 predicted 392
12 SASI_Mm01_00137466 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021330
ACP1 MISSION shRNA Bacterial Glycerol Stock
acid phosphatase 1, soluble
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-92s1c1
Sequence:CCGGGCAGAAGCAGTATTCAGGAAACTCGAGTTTCCTGAATACTGCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-389s1c1
Sequence:CCGGCCACAGAAACAGCTCATCATTCTCGAGAATGATGAGCTGTTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-202s1c1
Sequence:CCGGAGGGCAGAACTGCATGAGAAACTCGAGTTTCTCATGCAGTTCTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-240s1c1
Sequence:CCGGAGCACATTGCACGGCAGATTACTCGAGTAATCTGCCGTGCAATGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2878s21c1
Sequence:CCGGTCCTTGTGGTTCCACCTAATCCTCGAGGATTAGGTGGAACCACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2846s21c1
Sequence:CCGGTTAATGTTCTGCCTATGTTTCCTCGAGGAAACATAGGCAGAACATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2563s21c1
Sequence:CCGGCATTCTGAAGACTGTTCATTACTCGAGTAATGAACAGTCTTCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2385s21c1
Sequence:CCGGGATGGTAGATGTGGAGTATTGCTCGAGCAATACTCCACATCTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2419s21c1
Sequence:CCGGACCAAGCGATCAGGAGTTTATCTCGAGATAAACTCCTGATCGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021330
ACP1 MISSION shRNA shRNA Plasmid DNA
acid phosphatase 1, soluble
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-92s1c1
Sequence:CCGGGCAGAAGCAGTATTCAGGAAACTCGAGTTTCCTGAATACTGCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-389s1c1
Sequence:CCGGCCACAGAAACAGCTCATCATTCTCGAGAATGATGAGCTGTTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-202s1c1
Sequence:CCGGAGGGCAGAACTGCATGAGAAACTCGAGTTTCTCATGCAGTTCTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-240s1c1
Sequence:CCGGAGCACATTGCACGGCAGATTACTCGAGTAATCTGCCGTGCAATGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2878s21c1
Sequence:CCGGTCCTTGTGGTTCCACCTAATCCTCGAGGATTAGGTGGAACCACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2846s21c1
Sequence:CCGGTTAATGTTCTGCCTATGTTTCCTCGAGGAAACATAGGCAGAACATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2563s21c1
Sequence:CCGGCATTCTGAAGACTGTTCATTACTCGAGTAATGAACAGTCTTCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2385s21c1
Sequence:CCGGGATGGTAGATGTGGAGTATTGCTCGAGCAATACTCCACATCTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2419s21c1
Sequence:CCGGACCAAGCGATCAGGAGTTTATCTCGAGATAAACTCCTGATCGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021330
ACP1 MISSION shRNA Lentiviral Transduction Particles
acid phosphatase 1, soluble
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-92s1c1
Sequence:CCGGGCAGAAGCAGTATTCAGGAAACTCGAGTTTCCTGAATACTGCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-389s1c1
Sequence:CCGGCCACAGAAACAGCTCATCATTCTCGAGAATGATGAGCTGTTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-202s1c1
Sequence:CCGGAGGGCAGAACTGCATGAGAAACTCGAGTTTCTCATGCAGTTCTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021330.2-240s1c1
Sequence:CCGGAGCACATTGCACGGCAGATTACTCGAGTAATCTGCCGTGCAATGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2878s21c1
Sequence:CCGGTCCTTGTGGTTCCACCTAATCCTCGAGGATTAGGTGGAACCACAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2846s21c1
Sequence:CCGGTTAATGTTCTGCCTATGTTTCCTCGAGGAAACATAGGCAGAACATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2563s21c1
Sequence:CCGGCATTCTGAAGACTGTTCATTACTCGAGTAATGAACAGTCTTCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2385s21c1
Sequence:CCGGGATGGTAGATGTGGAGTATTGCTCGAGCAATACTCCACATCTACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021330.4-2419s21c1
Sequence:CCGGACCAAGCGATCAGGAGTTTATCTCGAGATAAACTCCTGATCGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007099
VALIDATED
ACP1 MISSION shRNA Bacterial Glycerol Stock
acid phosphatase 1, soluble
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007099.x-337s1c1
Sequence:CCGGCTATGTATGGATGAAAGCAATCTCGAGATTGCTTTCATCCATACATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007099.x-412s1c1
Sequence:CCGGGAACTACTTGGGAGCTATGATCTCGAGATCATAGCTCCCAAGTAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007099.x-292s1c1
Sequence:CCGGGCAAGACAGATTACCAAAGAACTCGAGTTCTTTGGTAATCTGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_007099.x-881s1c1
Sequence:CCGGGCCTGTTGAGACTTAGATAATCTCGAGATTATCTAAGTCTCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007099.x-283s1c1
Sequence:CCGGGCCCATAAAGCAAGACAGATTCTCGAGAATCTGTCTTGCTTTATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007099.3-274s21c1
Sequence:GTACCGGGCTGTGAGCTGCCTAAGAAATCTCGAGATTTCTTAGGCAGCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007099.3-299s21c1
Sequence:CCGGGCATTCACACAGCCCATAAAGCTCGAGCTTTATGGGCTGTGTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007099.3-1048s21c1
Sequence:CCGGGGAGCTCACAGTCTAGATTAGCTCGAGCTAATCTAGACTGTGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007099.3-128s21c1
Sequence:CCGGTTGTGTGTCTGGGTAACATTTCTCGAGAAATGTTACCCAGACACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007099.3-476s21c1
Sequence:CCGGTTATTGAAGATCCCTATTATGCTCGAGCATAATAGGGATCTTCAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007099.3-439s21c1
Sequence:CCGGGAACTACTTGGGAGCTATGATCTCGAGATCATAGCTCCCAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007099.3-179s21c1
Sequence:GTACCGGGGAAACTTGTAACCGATCAAACTCGAGTTTGATCGGTTACAAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007099.3-842s21c1
Sequence:GTACCGGATAGTAGAACAAGCAACATAACTCGAGTTATGTTGCTTGTTCTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007099
VALIDATED
ACP1 MISSION shRNA shRNA Plasmid DNA
acid phosphatase 1, soluble
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007099.x-337s1c1
Sequence:CCGGCTATGTATGGATGAAAGCAATCTCGAGATTGCTTTCATCCATACATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007099.x-412s1c1
Sequence:CCGGGAACTACTTGGGAGCTATGATCTCGAGATCATAGCTCCCAAGTAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007099.x-292s1c1
Sequence:CCGGGCAAGACAGATTACCAAAGAACTCGAGTTCTTTGGTAATCTGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_007099.x-881s1c1
Sequence:CCGGGCCTGTTGAGACTTAGATAATCTCGAGATTATCTAAGTCTCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007099.x-283s1c1
Sequence:CCGGGCCCATAAAGCAAGACAGATTCTCGAGAATCTGTCTTGCTTTATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007099.3-274s21c1
Sequence:GTACCGGGCTGTGAGCTGCCTAAGAAATCTCGAGATTTCTTAGGCAGCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007099.3-299s21c1
Sequence:CCGGGCATTCACACAGCCCATAAAGCTCGAGCTTTATGGGCTGTGTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007099.3-1048s21c1
Sequence:CCGGGGAGCTCACAGTCTAGATTAGCTCGAGCTAATCTAGACTGTGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007099.3-128s21c1
Sequence:CCGGTTGTGTGTCTGGGTAACATTTCTCGAGAAATGTTACCCAGACACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007099.3-476s21c1
Sequence:CCGGTTATTGAAGATCCCTATTATGCTCGAGCATAATAGGGATCTTCAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007099.3-439s21c1
Sequence:CCGGGAACTACTTGGGAGCTATGATCTCGAGATCATAGCTCCCAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007099.3-179s21c1
Sequence:GTACCGGGGAAACTTGTAACCGATCAAACTCGAGTTTGATCGGTTACAAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007099.3-842s21c1
Sequence:GTACCGGATAGTAGAACAAGCAACATAACTCGAGTTATGTTGCTTGTTCTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007099
VALIDATED
ACP1 MISSION shRNA Lentiviral Transduction Particles
acid phosphatase 1, soluble
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007099.x-337s1c1
Sequence:CCGGCTATGTATGGATGAAAGCAATCTCGAGATTGCTTTCATCCATACATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007099.x-412s1c1
Sequence:CCGGGAACTACTTGGGAGCTATGATCTCGAGATCATAGCTCCCAAGTAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007099.x-292s1c1
Sequence:CCGGGCAAGACAGATTACCAAAGAACTCGAGTTCTTTGGTAATCTGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_007099.x-881s1c1
Sequence:CCGGGCCTGTTGAGACTTAGATAATCTCGAGATTATCTAAGTCTCAACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007099.x-283s1c1
Sequence:CCGGGCCCATAAAGCAAGACAGATTCTCGAGAATCTGTCTTGCTTTATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007099.3-274s21c1
Sequence:GTACCGGGCTGTGAGCTGCCTAAGAAATCTCGAGATTTCTTAGGCAGCTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007099.3-299s21c1
Sequence:CCGGGCATTCACACAGCCCATAAAGCTCGAGCTTTATGGGCTGTGTGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007099.3-1048s21c1
Sequence:CCGGGGAGCTCACAGTCTAGATTAGCTCGAGCTAATCTAGACTGTGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007099.3-128s21c1
Sequence:CCGGTTGTGTGTCTGGGTAACATTTCTCGAGAAATGTTACCCAGACACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_007099.3-476s21c1
Sequence:CCGGTTATTGAAGATCCCTATTATGCTCGAGCATAATAGGGATCTTCAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007099.3-439s21c1
Sequence:CCGGGAACTACTTGGGAGCTATGATCTCGAGATCATAGCTCCCAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007099.3-179s21c1
Sequence:GTACCGGGGAAACTTGTAACCGATCAAACTCGAGTTTGATCGGTTACAAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007099.3-842s21c1
Sequence:GTACCGGATAGTAGAACAAGCAACATAACTCGAGTTATGTTGCTTGTTCTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks