EMAIL THIS PAGE TO A FRIEND

ACP2

acid phosphatase 2, lysosomal

126 Gene Product Result for
UniProtKB ID: P11117, E9PCI1, Q561W5, Q9BTU7
Gene ID:
Human(53) Summary: This gene encodes the beta subunit of lysosomal acid phosphatase (LAP). LAP is chemically and genetically distinct from red cell acid phosphatase. The encoded protein belongs to a family of distinct isoenzymes which hydrolyze orthophosphoric monoesters to alcohol and phosphate. Mutations in this gene or in the related alpha subunit gene cause acid phosphatase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Aug 2008]
Mouse(11432) acid phosphatase 2, lysosomal
Rat(24162) acid phosphatase 2, lysosomal
domestic guinea pig(100724733) acid phosphatase 2, lysosomal
naked mole-rat(101715936) acid phosphatase 2, lysosomal
sheep(101117016) acid phosphatase 2, lysosomal
Domestic Rabbit(100352644) acid phosphatase 2, lysosomal
Zebrafish(503759) acid phosphatase 2, lysosomal
Thale Cress(841900) acyl carrier protein 2
cow(535407) acid phosphatase 2, lysosomal
Horse(100057910) acid phosphatase 2, lysosomal
domestic cat(101092463) acid phosphatase 2, lysosomal
dog(475983) acid phosphatase 2, lysosomal
chicken(428864) acid phosphatase 2, lysosomal
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001610 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001610 siRNAs that have been validated in the lab human pricing
NM_016988 Rosetta Predictions rat pricing
NM_007387 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001610 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220018 validated 809
1 SASI_Hs01_00220016 validated 1542
1 SASI_Hs01_00220017 validated 321
2 SASI_Hs01_00220019 predicted 333
3 SASI_Hs01_00220020 predicted 433
4 SASI_Hs01_00220021 predicted 270
5 SASI_Hs01_00220023 predicted 548
6 SASI_Hs02_00332163 predicted 336
7 SASI_Hs01_00220025 predicted 537
8 SASI_Hs02_00332164 predicted 293
9 SASI_Hs02_00332165 predicted 751
10 SASI_Hs01_00220022 predicted 300
11 SASI_Hs01_00220024 predicted 1499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035008 predicted 478
2 SASI_Rn01_00035009 predicted 294
3 SASI_Rn01_00035010 predicted 966
4 SASI_Rn01_00035012 predicted 581
5 SASI_Rn01_00035013 predicted 516
6 SASI_Rn01_00035014 predicted 1328
7 SASI_Rn01_00035015 predicted 799
8 SASI_Rn01_00035016 predicted 777
9 SASI_Rn01_00035017 predicted 572
10 SASI_Rn02_00261122 predicted 1187
11 SASI_Rn01_00035011 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102434 predicted 922
2 SASI_Mm01_00102435 predicted 537
3 SASI_Mm01_00102436 predicted 965
4 SASI_Mm01_00102438 predicted 366
5 SASI_Mm01_00102439 predicted 522
6 SASI_Mm01_00102440 predicted 1240
7 SASI_Mm01_00102441 predicted 314
8 SASI_Mm01_00102442 predicted 495
9 SASI_Mm02_00311493 predicted 1179
10 SASI_Mm01_00102443 predicted 612
11 SASI_Mm01_00102437 predicted 844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001610
VALIDATED
ACP2 MISSION shRNA Bacterial Glycerol Stock
acid phosphatase 2, lysosomal
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001610.2-1564s21c1
Sequence:GTACCGGCATTCCCATGCCTGATGTTTACTCGAGTAAACATCAGGCATGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001610.2-1762s21c1
Sequence:CCGGGCCTGAAGTCTTCGGCAAATACTCGAGTATTTGCCGAAGACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001610.2-1036s21c1
Sequence:CCGGTACGCCTCCTGCCACATATTTCTCGAGAAATATGTGGCAGGAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001610.2-651s21c1
Sequence:CCGGGAGTTCTCGGAATGCACAATTCTCGAGAATTGTGCATTCCGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001610.2-400s21c1
Sequence:CCGGTATCACCGGCAAGAGGTTTATCTCGAGATAAACCTCTTGCCGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001610.2-897s21c1
Sequence:CCGGGCTGGCTCAGATAAGGAAGAACTCGAGTTCTTCCTTATCTGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001610.1-287s1c1
Sequence:CCGGCGGCTTCCTAAACACCTCTTACTCGAGTAAGAGGTGTTTAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001610.1-897s1c1
Sequence:CCGGGCCCTGCAAATGGCACTGGATCTCGAGATCCAGTGCCATTTGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001610.1-803s1c1
Sequence:CCGGGCTGGCTCAGATAAGGAAGAACTCGAGTTCTTCCTTATCTGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001610.1-156s1c1
Sequence:CCGGCGTTCACCAGTGAAGACATATCTCGAGATATGTCTTCACTGGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001610.1-566s1c1
Sequence:CCGGGAATGCACAATTTCTGGACATCTCGAGATGTCCAGAAATTGTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001610
VALIDATED
ACP2 MISSION shRNA shRNA Plasmid DNA
acid phosphatase 2, lysosomal
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001610.2-1564s21c1
Sequence:GTACCGGCATTCCCATGCCTGATGTTTACTCGAGTAAACATCAGGCATGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001610.2-1762s21c1
Sequence:CCGGGCCTGAAGTCTTCGGCAAATACTCGAGTATTTGCCGAAGACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001610.2-1036s21c1
Sequence:CCGGTACGCCTCCTGCCACATATTTCTCGAGAAATATGTGGCAGGAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001610.2-651s21c1
Sequence:CCGGGAGTTCTCGGAATGCACAATTCTCGAGAATTGTGCATTCCGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001610.2-400s21c1
Sequence:CCGGTATCACCGGCAAGAGGTTTATCTCGAGATAAACCTCTTGCCGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001610.2-897s21c1
Sequence:CCGGGCTGGCTCAGATAAGGAAGAACTCGAGTTCTTCCTTATCTGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001610.1-287s1c1
Sequence:CCGGCGGCTTCCTAAACACCTCTTACTCGAGTAAGAGGTGTTTAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001610.1-897s1c1
Sequence:CCGGGCCCTGCAAATGGCACTGGATCTCGAGATCCAGTGCCATTTGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001610.1-803s1c1
Sequence:CCGGGCTGGCTCAGATAAGGAAGAACTCGAGTTCTTCCTTATCTGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001610.1-156s1c1
Sequence:CCGGCGTTCACCAGTGAAGACATATCTCGAGATATGTCTTCACTGGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001610.1-566s1c1
Sequence:CCGGGAATGCACAATTTCTGGACATCTCGAGATGTCCAGAAATTGTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001610
VALIDATED
ACP2 MISSION shRNA Lentiviral Transduction Particles
acid phosphatase 2, lysosomal
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001610.2-1564s21c1
Sequence:GTACCGGCATTCCCATGCCTGATGTTTACTCGAGTAAACATCAGGCATGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001610.2-1762s21c1
Sequence:CCGGGCCTGAAGTCTTCGGCAAATACTCGAGTATTTGCCGAAGACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001610.2-1036s21c1
Sequence:CCGGTACGCCTCCTGCCACATATTTCTCGAGAAATATGTGGCAGGAGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001610.2-651s21c1
Sequence:CCGGGAGTTCTCGGAATGCACAATTCTCGAGAATTGTGCATTCCGAGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001610.2-400s21c1
Sequence:CCGGTATCACCGGCAAGAGGTTTATCTCGAGATAAACCTCTTGCCGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001610.2-897s21c1
Sequence:CCGGGCTGGCTCAGATAAGGAAGAACTCGAGTTCTTCCTTATCTGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001610.1-287s1c1
Sequence:CCGGCGGCTTCCTAAACACCTCTTACTCGAGTAAGAGGTGTTTAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001610.1-897s1c1
Sequence:CCGGGCCCTGCAAATGGCACTGGATCTCGAGATCCAGTGCCATTTGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001610.1-803s1c1
Sequence:CCGGGCTGGCTCAGATAAGGAAGAACTCGAGTTCTTCCTTATCTGAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001610.1-156s1c1
Sequence:CCGGCGTTCACCAGTGAAGACATATCTCGAGATATGTCTTCACTGGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001610.1-566s1c1
Sequence:CCGGGAATGCACAATTTCTGGACATCTCGAGATGTCCAGAAATTGTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007387
VALIDATED
ACP2 MISSION shRNA Bacterial Glycerol Stock
acid phosphatase 2, lysosomal
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007387.1-387s21c1
Sequence:CCGGCAGCACTTCAACCCTAACATTCTCGAGAATGTTAGGGTTGAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007387.1-924s21c1
Sequence:CCGGTATGCTTCCTGCCACATATTTCTCGAGAAATATGTGGCAGGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007387.1-1730s21c1
Sequence:CCGGGCAAATCACTAGGAGTATAAACTCGAGTTTATACTCCTAGTGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007387.1-1139s21c1
Sequence:CCGGCACAGAGGTAATTGTGGCATTCTCGAGAATGCCACAATTACCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007387.1-520s21c1
Sequence:CCGGCACCAGAGTATCAGAACAGAACTCGAGTTCTGTTCTGATACTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-2527s1c1
Sequence:CCGGGCTCCAAATGAGAATATGATACTCGAGTATCATATTCTCATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-387s1c1
Sequence:CCGGCAGCACTTCAACCCTAACATTCTCGAGAATGTTAGGGTTGAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-1139s1c1
Sequence:CCGGCACAGAGGTAATTGTGGCATTCTCGAGAATGCCACAATTACCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-386s1c1
Sequence:CCGGTCAGCACTTCAACCCTAACATCTCGAGATGTTAGGGTTGAAGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-520s1c1
Sequence:CCGGCACCAGAGTATCAGAACAGAACTCGAGTTCTGTTCTGATACTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007387
VALIDATED
ACP2 MISSION shRNA shRNA Plasmid DNA
acid phosphatase 2, lysosomal
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007387.1-387s21c1
Sequence:CCGGCAGCACTTCAACCCTAACATTCTCGAGAATGTTAGGGTTGAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007387.1-924s21c1
Sequence:CCGGTATGCTTCCTGCCACATATTTCTCGAGAAATATGTGGCAGGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007387.1-1730s21c1
Sequence:CCGGGCAAATCACTAGGAGTATAAACTCGAGTTTATACTCCTAGTGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007387.1-1139s21c1
Sequence:CCGGCACAGAGGTAATTGTGGCATTCTCGAGAATGCCACAATTACCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007387.1-520s21c1
Sequence:CCGGCACCAGAGTATCAGAACAGAACTCGAGTTCTGTTCTGATACTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-2527s1c1
Sequence:CCGGGCTCCAAATGAGAATATGATACTCGAGTATCATATTCTCATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-387s1c1
Sequence:CCGGCAGCACTTCAACCCTAACATTCTCGAGAATGTTAGGGTTGAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-1139s1c1
Sequence:CCGGCACAGAGGTAATTGTGGCATTCTCGAGAATGCCACAATTACCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-386s1c1
Sequence:CCGGTCAGCACTTCAACCCTAACATCTCGAGATGTTAGGGTTGAAGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-520s1c1
Sequence:CCGGCACCAGAGTATCAGAACAGAACTCGAGTTCTGTTCTGATACTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007387
VALIDATED
ACP2 MISSION shRNA Lentiviral Transduction Particles
acid phosphatase 2, lysosomal
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007387.1-387s21c1
Sequence:CCGGCAGCACTTCAACCCTAACATTCTCGAGAATGTTAGGGTTGAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007387.1-924s21c1
Sequence:CCGGTATGCTTCCTGCCACATATTTCTCGAGAAATATGTGGCAGGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007387.1-1730s21c1
Sequence:CCGGGCAAATCACTAGGAGTATAAACTCGAGTTTATACTCCTAGTGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007387.1-1139s21c1
Sequence:CCGGCACAGAGGTAATTGTGGCATTCTCGAGAATGCCACAATTACCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007387.1-520s21c1
Sequence:CCGGCACCAGAGTATCAGAACAGAACTCGAGTTCTGTTCTGATACTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-2527s1c1
Sequence:CCGGGCTCCAAATGAGAATATGATACTCGAGTATCATATTCTCATTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-387s1c1
Sequence:CCGGCAGCACTTCAACCCTAACATTCTCGAGAATGTTAGGGTTGAAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-1139s1c1
Sequence:CCGGCACAGAGGTAATTGTGGCATTCTCGAGAATGCCACAATTACCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-386s1c1
Sequence:CCGGTCAGCACTTCAACCCTAACATCTCGAGATGTTAGGGTTGAAGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007387.1-520s1c1
Sequence:CCGGCACCAGAGTATCAGAACAGAACTCGAGTTCTGTTCTGATACTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks