EMAIL THIS PAGE TO A FRIEND

ACP5

acid phosphatase 5, tartrate resistant

115 Gene Product Result for
Synonyms: SPENCDI TRAP
Gene ID:
Human(54) Summary: This gene encodes an iron containing glycoprotein which catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is the most basic of the acid phosphatases and is the only form not inhibited by L(+)-tartrate. [provided by RefSeq, Aug 2008]
Mouse(11433) acid phosphatase 5, tartrate resistant
Rat(25732) acid phosphatase 5, tartrate resistant
Thale Cress(832778) acyl carrier protein 5
dog(476705) acid phosphatase 5, tartrate resistant
domestic cat(101100541) acid phosphatase 5, tartrate resistant
cow(517002) acid phosphatase 5, tartrate resistant
Horse(100056621) acid phosphatase 5, tartrate resistant
sheep(100820744) acid phosphatase 5, tartrate resistant
Domestic Rabbit(100008599) acid phosphatase 5, tartrate resistant
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1755 Human TRACP ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001611 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111034 Rosetta Predictions human pricing
NM_001111035 Rosetta Predictions human pricing
NM_001111036 Rosetta Predictions human pricing
NM_001611 Rosetta Predictions human pricing
NM_019144 Rosetta Predictions rat pricing
NM_001102404 Rosetta Predictions mouse pricing
NM_001102405 Rosetta Predictions mouse pricing
NM_007388 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325126 predicted 602
2 SASI_Hs02_00325127 predicted 631
3 SASI_Hs02_00325128 predicted 749
4 SASI_Hs02_00325129 predicted 531
5 SASI_Hs02_00325130 predicted 1012
6 SASI_Hs02_00325131 predicted 1106
7 SASI_Hs02_00325132 predicted 1318
8 SASI_Hs02_00325133 predicted 678
9 SASI_Hs02_00325134 predicted 1210
10 SASI_Hs02_00325135 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325136 predicted 626
2 SASI_Hs02_00325137 predicted 656
3 SASI_Hs02_00325138 predicted 771
4 SASI_Hs02_00325139 predicted 554
5 SASI_Hs02_00325140 predicted 1029
6 SASI_Hs02_00325141 predicted 1129
7 SASI_Hs02_00325142 predicted 1343
8 SASI_Hs02_00325143 predicted 705
9 SASI_Hs02_00325144 predicted 1227
10 SASI_Hs02_00325145 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325146 predicted 552
2 SASI_Hs02_00325147 predicted 578
3 SASI_Hs02_00325148 predicted 695
4 SASI_Hs02_00325149 predicted 472
5 SASI_Hs02_00325150 predicted 958
6 SASI_Hs02_00325151 predicted 1057
7 SASI_Hs02_00325152 predicted 1273
8 SASI_Hs02_00325153 predicted 629
9 SASI_Hs02_00325154 predicted 1157
10 SASI_Hs02_00325155 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157801 predicted 474
2 SASI_Hs01_00157802 predicted 502
3 SASI_Hs02_00332166 predicted 610
4 SASI_Hs01_00157803 predicted 391
5 SASI_Hs01_00157804 predicted 873
6 SASI_Hs01_00157805 predicted 966
7 SASI_Hs01_00157806 predicted 1184
8 SASI_Hs01_00157807 predicted 545
9 SASI_Hs01_00157808 predicted 1072
10 SASI_Hs01_00157809 predicted 783
11 SASI_Hs01_00157810 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040340 predicted 943
2 SASI_Rn01_00040341 predicted 233
3 SASI_Rn01_00040345 predicted 923
4 SASI_Rn01_00040346 predicted 423
5 SASI_Rn01_00040347 predicted 763
6 SASI_Rn02_00261912 predicted 919
7 SASI_Rn02_00261913 predicted 261
8 SASI_Rn01_00040348 predicted 1075
9 SASI_Rn01_00040349 predicted 678
10 SASI_Rn02_00261914 predicted 492
11 SASI_Rn01_00040342 predicted 410
12 SASI_Rn01_00040343 predicted 641
13 SASI_Rn01_00040344 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302684 predicted 599
2 SASI_Mm02_00302685 predicted 958
3 SASI_Mm02_00302686 predicted 371
4 SASI_Mm02_00302687 predicted 602
5 SASI_Mm02_00302688 predicted 487
6 SASI_Mm02_00302689 predicted 831
7 SASI_Mm02_00302690 predicted 959
8 SASI_Mm02_00302691 predicted 481
9 SASI_Mm02_00302692 predicted 472
10 SASI_Mm02_00302693 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302694 predicted 605
2 SASI_Mm02_00302695 predicted 968
3 SASI_Mm02_00302696 predicted 375
4 SASI_Mm02_00302697 predicted 607
5 SASI_Mm02_00302698 predicted 493
6 SASI_Mm02_00302699 predicted 834
7 SASI_Mm02_00302700 predicted 967
8 SASI_Mm02_00302701 predicted 492
9 SASI_Mm02_00302702 predicted 484
10 SASI_Mm02_00302703 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311494 predicted 551
2 SASI_Mm01_00062826 predicted 902
3 SASI_Mm01_00062827 predicted 320
4 SASI_Mm01_00062828 predicted 547
5 SASI_Mm01_00062829 predicted 430
6 SASI_Mm01_00062830 predicted 775
7 SASI_Mm01_00062831 predicted 904
8 SASI_Mm01_00062832 predicted 437
9 SASI_Mm01_00062833 predicted 417
10 SASI_Mm01_00062834 predicted 745
11 SASI_Mm01_00062825 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007388
VALIDATED
ACP5 MISSION shRNA Bacterial Glycerol Stock
acid phosphatase 5, tartrate resistant
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007388.1-810s1c1
Sequence:CCGGGCGACCATTGTTAGCCACATACTCGAGTATGTGGCTAACAATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007388.1-589s1c1
Sequence:CCGGGCCATCTTTATGCTGGACACACTCGAGTGTGTCCAGCATAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007388.1-1034s1c1
Sequence:CCGGCCAAAGAAATGACCATCATATCTCGAGATATGATGGTCATTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007388.1-1010s1c1
Sequence:CCGGGCTTCACACATGTGGAGATAACTCGAGTTATCTCCACATGTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007388.1-1204s1c1
Sequence:CCGGCGGCAGCTTCTCTGCCCTGGTCTCGAGACCAGGGCAGAGAAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-754s21c1
Sequence:CCGGGCGACCATTGTTAGCCACATACTCGAGTATGTGGCTAACAATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-979s21c1
Sequence:CCGGCAAAGAAATGACCATCATATACTCGAGTATATGATGGTCATTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007388.3-1069s21c1
Sequence:CCGGAGAGTCCTGCTTGTCCGCTAACTCGAGTTAGCGGACAAGCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-912s21c1
Sequence:CCGGGCTACTTGCGGTTTCACTATGCTCGAGCATAGTGAAACCGCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-522s21c1
Sequence:CCGGACATAACTGTGGCCATCTTTACTCGAGTAAAGATGGCCACAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007388
VALIDATED
ACP5 MISSION shRNA shRNA Plasmid DNA
acid phosphatase 5, tartrate resistant
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007388.1-810s1c1
Sequence:CCGGGCGACCATTGTTAGCCACATACTCGAGTATGTGGCTAACAATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007388.1-589s1c1
Sequence:CCGGGCCATCTTTATGCTGGACACACTCGAGTGTGTCCAGCATAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007388.1-1034s1c1
Sequence:CCGGCCAAAGAAATGACCATCATATCTCGAGATATGATGGTCATTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007388.1-1010s1c1
Sequence:CCGGGCTTCACACATGTGGAGATAACTCGAGTTATCTCCACATGTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007388.1-1204s1c1
Sequence:CCGGCGGCAGCTTCTCTGCCCTGGTCTCGAGACCAGGGCAGAGAAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-754s21c1
Sequence:CCGGGCGACCATTGTTAGCCACATACTCGAGTATGTGGCTAACAATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-979s21c1
Sequence:CCGGCAAAGAAATGACCATCATATACTCGAGTATATGATGGTCATTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007388.3-1069s21c1
Sequence:CCGGAGAGTCCTGCTTGTCCGCTAACTCGAGTTAGCGGACAAGCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-912s21c1
Sequence:CCGGGCTACTTGCGGTTTCACTATGCTCGAGCATAGTGAAACCGCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-522s21c1
Sequence:CCGGACATAACTGTGGCCATCTTTACTCGAGTAAAGATGGCCACAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007388
VALIDATED
ACP5 MISSION shRNA Lentiviral Transduction Particles
acid phosphatase 5, tartrate resistant
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007388.1-810s1c1
Sequence:CCGGGCGACCATTGTTAGCCACATACTCGAGTATGTGGCTAACAATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007388.1-589s1c1
Sequence:CCGGGCCATCTTTATGCTGGACACACTCGAGTGTGTCCAGCATAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007388.1-1034s1c1
Sequence:CCGGCCAAAGAAATGACCATCATATCTCGAGATATGATGGTCATTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007388.1-1010s1c1
Sequence:CCGGGCTTCACACATGTGGAGATAACTCGAGTTATCTCCACATGTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007388.1-1204s1c1
Sequence:CCGGCGGCAGCTTCTCTGCCCTGGTCTCGAGACCAGGGCAGAGAAGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-754s21c1
Sequence:CCGGGCGACCATTGTTAGCCACATACTCGAGTATGTGGCTAACAATGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-979s21c1
Sequence:CCGGCAAAGAAATGACCATCATATACTCGAGTATATGATGGTCATTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007388.3-1069s21c1
Sequence:CCGGAGAGTCCTGCTTGTCCGCTAACTCGAGTTAGCGGACAAGCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-912s21c1
Sequence:CCGGGCTACTTGCGGTTTCACTATGCTCGAGCATAGTGAAACCGCAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007388.3-522s21c1
Sequence:CCGGACATAACTGTGGCCATCTTTACTCGAGTAAAGATGGCCACAGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001611
ACP5 MISSION shRNA Bacterial Glycerol Stock
acid phosphatase 5, tartrate resistant
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-446s1c1
Sequence:CCGGCCAGATTGCATACTCTAAGATCTCGAGATCTTAGAGTATGCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-276s1c1
Sequence:CCGGGCAGACTTCATCCTGTCTCTACTCGAGTAGAGACAGGATGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-1015s1c1
Sequence:CCGGCCTCGGGCAAGTCCCTCTTTACTCGAGTAAAGAGGGACTTGCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-557s1c1
Sequence:CCGGCACAGTGACACTATGTGGCAACTCGAGTTGCCACATAGTGTCACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-822s1c1
Sequence:CCGGCAGTACCTGCAAGATGAGAATCTCGAGATTCTCATCTTGCAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-490s21c1
Sequence:CCGGGCAATGTCTCTGCCCAGATTGCTCGAGCAATCTGGGCAGAGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-1073s21c1
Sequence:CCGGCTCGGGCAAGTCCCTCTTTAACTCGAGTTAAAGAGGGACTTGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-408s21c1
Sequence:CCGGGAGACCTTTGAGGACGTATTCCTCGAGGAATACGTCCTCAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-880s21c1
Sequence:CCGGAGTACCTGCAAGATGAGAATGCTCGAGCATTCTCATCTTGCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001611
ACP5 MISSION shRNA shRNA Plasmid DNA
acid phosphatase 5, tartrate resistant
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-446s1c1
Sequence:CCGGCCAGATTGCATACTCTAAGATCTCGAGATCTTAGAGTATGCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-276s1c1
Sequence:CCGGGCAGACTTCATCCTGTCTCTACTCGAGTAGAGACAGGATGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-1015s1c1
Sequence:CCGGCCTCGGGCAAGTCCCTCTTTACTCGAGTAAAGAGGGACTTGCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-557s1c1
Sequence:CCGGCACAGTGACACTATGTGGCAACTCGAGTTGCCACATAGTGTCACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-822s1c1
Sequence:CCGGCAGTACCTGCAAGATGAGAATCTCGAGATTCTCATCTTGCAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-490s21c1
Sequence:CCGGGCAATGTCTCTGCCCAGATTGCTCGAGCAATCTGGGCAGAGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-1073s21c1
Sequence:CCGGCTCGGGCAAGTCCCTCTTTAACTCGAGTTAAAGAGGGACTTGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-408s21c1
Sequence:CCGGGAGACCTTTGAGGACGTATTCCTCGAGGAATACGTCCTCAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-880s21c1
Sequence:CCGGAGTACCTGCAAGATGAGAATGCTCGAGCATTCTCATCTTGCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001611
ACP5 MISSION shRNA Lentiviral Transduction Particles
acid phosphatase 5, tartrate resistant
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-446s1c1
Sequence:CCGGCCAGATTGCATACTCTAAGATCTCGAGATCTTAGAGTATGCAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-276s1c1
Sequence:CCGGGCAGACTTCATCCTGTCTCTACTCGAGTAGAGACAGGATGAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-1015s1c1
Sequence:CCGGCCTCGGGCAAGTCCCTCTTTACTCGAGTAAAGAGGGACTTGCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-557s1c1
Sequence:CCGGCACAGTGACACTATGTGGCAACTCGAGTTGCCACATAGTGTCACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001611.2-822s1c1
Sequence:CCGGCAGTACCTGCAAGATGAGAATCTCGAGATTCTCATCTTGCAGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-490s21c1
Sequence:CCGGGCAATGTCTCTGCCCAGATTGCTCGAGCAATCTGGGCAGAGACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-1073s21c1
Sequence:CCGGCTCGGGCAAGTCCCTCTTTAACTCGAGTTAAAGAGGGACTTGCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-408s21c1
Sequence:CCGGGAGACCTTTGAGGACGTATTCCTCGAGGAATACGTCCTCAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001611.3-880s21c1
Sequence:CCGGAGTACCTGCAAGATGAGAATGCTCGAGCATTCTCATCTTGCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks