EMAIL THIS PAGE TO A FRIEND

ACP6

acid phosphatase 6, lysophosphatidic

63 Gene Product Result for
Synonyms: ACPL1 LPAP PACPL1
UniProtKB ID: Q9NPH0, Q59G61, Q5T490, Q6IAQ3, Q7LG81, Q9UIG6
Gene ID:
Mouse(66659) acid phosphatase 6, lysophosphatidic
Rat(295305) acid phosphatase 6, lysophosphatidic
Zebrafish(558758) acid phosphatase 6, lysophosphatidic
cow(515738) acid phosphatase 6, lysophosphatidic
Horse(100065568) acid phosphatase 6, lysophosphatidic
chicken(418458) acid phosphatase 6, lysophosphatidic
domestic cat(101093289) acid phosphatase 6, lysophosphatidic
dog(475822) acid phosphatase 6, lysophosphatidic
domestic guinea pig(100728662) acid phosphatase 6, lysophosphatidic
naked mole-rat(101725554) acid phosphatase 6, lysophosphatidic
sheep(101114832) acid phosphatase 6, lysophosphatidic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016361 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026551 MISSION® esiRNA esiRNA human ACP6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016361 Rosetta Predictions human pricing
NM_001031645 Rosetta Predictions rat pricing
NM_019800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349336 predicted 1185
2 SASI_Hs01_00055722 predicted 1039
3 SASI_Hs01_00055723 predicted 767
4 SASI_Hs01_00055724 predicted 1048
5 SASI_Hs02_00349337 predicted 1272
6 SASI_Hs01_00055728 predicted 1446
7 SASI_Hs02_00349338 predicted 1365
8 SASI_Hs01_00055729 predicted 1141
9 SASI_Hs02_00349339 predicted 1453
10 SASI_Hs02_00349340 predicted 1314
11 SASI_Hs01_00055725 predicted 1260
12 SASI_Hs01_00055726 predicted 1416
13 SASI_Hs01_00055727 predicted 1489
14 SASI_Hs01_00055730 predicted 1544
15 SASI_Hs01_00055731 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203580 predicted 823
2 SASI_Rn01_00112323 predicted 789
3 SASI_Rn01_00112324 predicted 630
4 SASI_Rn01_00112326 predicted 541
5 SASI_Rn01_00112327 predicted 811
6 SASI_Rn02_00203581 predicted 650
7 SASI_Rn01_00112328 predicted 634
8 SASI_Rn01_00112329 predicted 223
9 SASI_Rn01_00112330 predicted 351
10 SASI_Rn01_00112331 predicted 1042
11 SASI_Rn01_00112325 predicted 458
12 SASI_Rn01_00112332 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325043 predicted 1083
2 SASI_Mm02_00325044 predicted 666
3 SASI_Mm01_00145365 predicted 1208
4 SASI_Mm01_00145367 predicted 1159
5 SASI_Mm01_00145368 predicted 1026
6 SASI_Mm01_00145370 predicted 1325
7 SASI_Mm01_00145371 predicted 1336
8 SASI_Mm01_00145372 predicted 1457
9 SASI_Mm01_00145373 predicted 1327
10 SASI_Mm01_00145374 predicted 659
11 SASI_Mm01_00145366 predicted 1419
12 SASI_Mm01_00145369 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016361
VALIDATED
ACP6 MISSION shRNA Bacterial Glycerol Stock
acid phosphatase 6, lysophosphatidic
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1535s21c1
Sequence:GTACCGGTGACCTGACCATGGAACTTTACTCGAGTAAAGTTCCATGGTCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1190s21c1
Sequence:CCGGCAGTAGTGATAAAGTGGACTTCTCGAGAAGTCCACTTTATCACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-728s21c1
Sequence:CCGGGTTTGATTACACAGTCACCAACTCGAGTTGGTGACTGTGTAATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1665s21c1
Sequence:CCGGGCCATGTCAGTTTATACCTTACTCGAGTAAGGTATAAACTGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1050s21c1
Sequence:CCGGGCAGATTCAGAAGTCTTGTATCTCGAGATACAAGACTTCTGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-1645s1c1
Sequence:CCGGGCCATGTCAGTTTATACCTTACTCGAGTAAGGTATAAACTGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-708s1c1
Sequence:CCGGGTTTGATTACACAGTCACCAACTCGAGTTGGTGACTGTGTAATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-1170s1c1
Sequence:CCGGCAGTAGTGATAAAGTGGACTTCTCGAGAAGTCCACTTTATCACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-1030s1c1
Sequence:CCGGGCAGATTCAGAAGTCTTGTATCTCGAGATACAAGACTTCTGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016361.2-1251s1c1
Sequence:CCGGGCTGAAGAGATTTGCACGGATCTCGAGATCCGTGCAAATCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016361
VALIDATED
ACP6 MISSION shRNA shRNA Plasmid DNA
acid phosphatase 6, lysophosphatidic
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1535s21c1
Sequence:GTACCGGTGACCTGACCATGGAACTTTACTCGAGTAAAGTTCCATGGTCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1190s21c1
Sequence:CCGGCAGTAGTGATAAAGTGGACTTCTCGAGAAGTCCACTTTATCACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-728s21c1
Sequence:CCGGGTTTGATTACACAGTCACCAACTCGAGTTGGTGACTGTGTAATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1665s21c1
Sequence:CCGGGCCATGTCAGTTTATACCTTACTCGAGTAAGGTATAAACTGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1050s21c1
Sequence:CCGGGCAGATTCAGAAGTCTTGTATCTCGAGATACAAGACTTCTGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-1645s1c1
Sequence:CCGGGCCATGTCAGTTTATACCTTACTCGAGTAAGGTATAAACTGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-708s1c1
Sequence:CCGGGTTTGATTACACAGTCACCAACTCGAGTTGGTGACTGTGTAATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-1170s1c1
Sequence:CCGGCAGTAGTGATAAAGTGGACTTCTCGAGAAGTCCACTTTATCACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-1030s1c1
Sequence:CCGGGCAGATTCAGAAGTCTTGTATCTCGAGATACAAGACTTCTGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016361.2-1251s1c1
Sequence:CCGGGCTGAAGAGATTTGCACGGATCTCGAGATCCGTGCAAATCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016361
VALIDATED
ACP6 MISSION shRNA Lentiviral Transduction Particles
acid phosphatase 6, lysophosphatidic
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1535s21c1
Sequence:GTACCGGTGACCTGACCATGGAACTTTACTCGAGTAAAGTTCCATGGTCAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1190s21c1
Sequence:CCGGCAGTAGTGATAAAGTGGACTTCTCGAGAAGTCCACTTTATCACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-728s21c1
Sequence:CCGGGTTTGATTACACAGTCACCAACTCGAGTTGGTGACTGTGTAATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1665s21c1
Sequence:CCGGGCCATGTCAGTTTATACCTTACTCGAGTAAGGTATAAACTGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016361.3-1050s21c1
Sequence:CCGGGCAGATTCAGAAGTCTTGTATCTCGAGATACAAGACTTCTGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-1645s1c1
Sequence:CCGGGCCATGTCAGTTTATACCTTACTCGAGTAAGGTATAAACTGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-708s1c1
Sequence:CCGGGTTTGATTACACAGTCACCAACTCGAGTTGGTGACTGTGTAATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-1170s1c1
Sequence:CCGGCAGTAGTGATAAAGTGGACTTCTCGAGAAGTCCACTTTATCACTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016361.2-1030s1c1
Sequence:CCGGGCAGATTCAGAAGTCTTGTATCTCGAGATACAAGACTTCTGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016361.2-1251s1c1
Sequence:CCGGGCTGAAGAGATTTGCACGGATCTCGAGATCCGTGCAAATCTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019800
VALIDATED
ACP6 MISSION shRNA Bacterial Glycerol Stock
acid phosphatase 6, lysophosphatidic
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-1444s21c1
Sequence:CCGGTACCAGCACCAAGAATCTAAGCTCGAGCTTAGATTCTTGGTGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-839s21c1
Sequence:CCGGTTCGCTCCACCAACATGTTTCCTCGAGGAAACATGTTGGTGGAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-653s21c1
Sequence:CCGGGCCCGAAACCTCATTCTCATTCTCGAGAATGAGAATGAGGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-1328s21c1
Sequence:CCGGCCAGAAAGATGTACCTCTATGCTCGAGCATAGAGGTACATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-597s21c1
Sequence:CCGGTTTAGAGATCCCACCTCAAACCTCGAGGTTTGAGGTGGGATCTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019800.1-143s1c1
Sequence:CCGGGCCCGAAACCTCATTCTCATTCTCGAGAATGAGAATGAGGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019800.1-942s1c1
Sequence:CCGGCCAAGAATCTAAGGAGTGGTTCTCGAGAACCACTCCTTAGATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019800.1-97s1c1
Sequence:CCGGCCACCTCAAACTCGGTTTGATCTCGAGATCAAACCGAGTTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019800.1-621s1c1
Sequence:CCGGGCAGGTACACAGCCTTCTAAACTCGAGTTTAGAAGGCTGTGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019800
VALIDATED
ACP6 MISSION shRNA shRNA Plasmid DNA
acid phosphatase 6, lysophosphatidic
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-1444s21c1
Sequence:CCGGTACCAGCACCAAGAATCTAAGCTCGAGCTTAGATTCTTGGTGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-839s21c1
Sequence:CCGGTTCGCTCCACCAACATGTTTCCTCGAGGAAACATGTTGGTGGAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-653s21c1
Sequence:CCGGGCCCGAAACCTCATTCTCATTCTCGAGAATGAGAATGAGGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-1328s21c1
Sequence:CCGGCCAGAAAGATGTACCTCTATGCTCGAGCATAGAGGTACATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-597s21c1
Sequence:CCGGTTTAGAGATCCCACCTCAAACCTCGAGGTTTGAGGTGGGATCTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019800.1-143s1c1
Sequence:CCGGGCCCGAAACCTCATTCTCATTCTCGAGAATGAGAATGAGGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019800.1-942s1c1
Sequence:CCGGCCAAGAATCTAAGGAGTGGTTCTCGAGAACCACTCCTTAGATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019800.1-97s1c1
Sequence:CCGGCCACCTCAAACTCGGTTTGATCTCGAGATCAAACCGAGTTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019800.1-621s1c1
Sequence:CCGGGCAGGTACACAGCCTTCTAAACTCGAGTTTAGAAGGCTGTGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019800
VALIDATED
ACP6 MISSION shRNA Lentiviral Transduction Particles
acid phosphatase 6, lysophosphatidic
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-1444s21c1
Sequence:CCGGTACCAGCACCAAGAATCTAAGCTCGAGCTTAGATTCTTGGTGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-839s21c1
Sequence:CCGGTTCGCTCCACCAACATGTTTCCTCGAGGAAACATGTTGGTGGAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-653s21c1
Sequence:CCGGGCCCGAAACCTCATTCTCATTCTCGAGAATGAGAATGAGGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-1328s21c1
Sequence:CCGGCCAGAAAGATGTACCTCTATGCTCGAGCATAGAGGTACATCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019800.3-597s21c1
Sequence:CCGGTTTAGAGATCCCACCTCAAACCTCGAGGTTTGAGGTGGGATCTCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019800.1-143s1c1
Sequence:CCGGGCCCGAAACCTCATTCTCATTCTCGAGAATGAGAATGAGGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019800.1-942s1c1
Sequence:CCGGCCAAGAATCTAAGGAGTGGTTCTCGAGAACCACTCCTTAGATTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019800.1-97s1c1
Sequence:CCGGCCACCTCAAACTCGGTTTGATCTCGAGATCAAACCGAGTTTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019800.1-621s1c1
Sequence:CCGGGCAGGTACACAGCCTTCTAAACTCGAGTTTAGAAGGCTGTGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks