EMAIL THIS PAGE TO A FRIEND

ACPL2

acid phosphatase-like 2

171 Gene Product Result for
UniProtKB ID: Q8TE99, D3DNF5, Q49AJ2
Gene ID:
Mouse(235534) acid phosphatase-like 2
Rat(315939) acid phosphatase-like 2
Zebrafish(436703) acid phosphatase-like 2
chicken(424815) acid phosphatase-like 2
dog(611289) acid phosphatase-like 2
cow(537248) acid phosphatase-like 2
Horse(100063528) acid phosphatase-like 2
domestic cat(101089794) acid phosphatase-like 2
sheep(101107655) acid phosphatase-like 2
Domestic Rabbit(100356728) acid phosphatase-like 2
naked mole-rat(101723262) acid phosphatase-like 2
domestic guinea pig(100730494) acid phosphatase-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103920 Anti-ACPL2 antibody produced in rabbit affinity isolated antibody horse, guinea pig, rabbit, rat, canine, human, mouse
western blot pricing
SAB2103919 Anti-ACPL2, (N-terminal) antibody produced in rabbit affinity isolated antibody zebrafish, mouse, canine, rat, guinea pig, rabbit, human, horse
western blot pricing
HPA017243 Anti-PXYLP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152282 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037172 Rosetta Predictions human pricing
NM_152282 Rosetta Predictions human pricing
NM_001007710 Rosetta Predictions rat pricing
XM_001065462 Rosetta Predictions rat pricing
XM_001065528 Rosetta Predictions rat pricing
XM_001065588 Rosetta Predictions rat pricing
NM_153420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216294 predicted 588
2 SASI_Hs01_00216295 predicted 853
3 SASI_Hs01_00216296 predicted 1359
4 SASI_Hs01_00216297 predicted 1042
5 SASI_Hs01_00216298 predicted 1598
6 SASI_Hs01_00216299 predicted 508
7 SASI_Hs01_00216300 predicted 629
8 SASI_Hs01_00216301 predicted 1571
9 SASI_Hs01_00216302 predicted 478
10 SASI_Hs01_00216303 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055592 predicted 771
2 SASI_Hs01_00055593 predicted 1029
3 SASI_Hs01_00055594 predicted 1534
4 SASI_Hs01_00055595 predicted 1207
5 SASI_Hs01_00055596 predicted 1769
6 SASI_Hs01_00055597 predicted 684
7 SASI_Hs01_00055598 predicted 801
8 SASI_Hs01_00055599 predicted 1744
9 SASI_Hs01_00055600 predicted 654
10 SASI_Hs01_00055601 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103740 predicted 1658
2 SASI_Rn01_00103741 predicted 1658
3 SASI_Rn01_00103742 predicted 1667
4 SASI_Rn01_00103743 predicted 1067
5 SASI_Rn02_00198885 predicted 767
6 SASI_Rn01_00103745 predicted 1828
7 SASI_Rn01_00103746 predicted 1464
8 SASI_Rn01_00103747 predicted 1581
9 SASI_Rn01_00103748 predicted 457
10 SASI_Rn01_00103749 predicted 482
11 SASI_Rn01_00103744 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314229 predicted 887
2 SASI_Rn02_00314230 predicted 941
3 SASI_Rn02_00314231 predicted 1067
4 SASI_Rn02_00314232 predicted 1166
5 SASI_Rn02_00314233 predicted 789
6 SASI_Rn02_00314234 predicted 633
7 SASI_Rn02_00314235 predicted 1550
8 SASI_Rn02_00314236 predicted 961
9 SASI_Rn02_00314237 predicted 1671
10 SASI_Rn02_00314238 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314484 predicted 874
2 SASI_Rn02_00314485 predicted 820
3 SASI_Rn02_00314486 predicted 1090
4 SASI_Rn02_00314487 predicted 561
5 SASI_Rn02_00314488 predicted 1488
6 SASI_Rn02_00314489 predicted 1603
7 SASI_Rn02_00314490 predicted 525
8 SASI_Rn02_00314491 predicted 876
9 SASI_Rn02_00314492 predicted 746
10 SASI_Rn02_00314493 predicted 1616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314757 predicted 824
2 SASI_Rn02_00314758 predicted 874
3 SASI_Rn02_00314759 predicted 1000
4 SASI_Rn02_00314760 predicted 1094
5 SASI_Rn02_00314761 predicted 723
6 SASI_Rn02_00314762 predicted 561
7 SASI_Rn02_00314763 predicted 1485
8 SASI_Rn02_00314764 predicted 889
9 SASI_Rn02_00314765 predicted 1605
10 SASI_Rn02_00314766 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197704 predicted 1577
2 SASI_Mm01_00197705 predicted 1003
3 SASI_Mm01_00197706 predicted 1836
4 SASI_Mm01_00197707 predicted 699
5 SASI_Mm01_00197708 predicted 1301
6 SASI_Mm01_00197709 predicted 504
7 SASI_Mm01_00197710 predicted 1575
8 SASI_Mm01_00197711 predicted 706
9 SASI_Mm01_00197712 predicted 1744
10 SASI_Mm02_00343214 predicted 1698
11 SASI_Mm01_00197713 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153420
VALIDATED
ACPL2 MISSION shRNA Bacterial Glycerol Stock
acid phosphatase-like 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153420.1-2582s1c1
Sequence:CCGGCCGTAGTCTATTGGCTGCATACTCGAGTATGCAGCCAATAGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153420.1-526s1c1
Sequence:CCGGGCTCTTCTGTACTGCAACATTCTCGAGAATGTTGCAGTACAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153420.1-1578s1c1
Sequence:CCGGCAGTGAACATTCGGTCCGAATCTCGAGATTCGGACCGAATGTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153420.1-1129s1c1
Sequence:CCGGCGTTTGAAGAACAGCGACCTACTCGAGTAGGTCGCTGTTCTTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153420.1-1695s1c1
Sequence:CCGGCCGCTTTGTCAAACGGGATATCTCGAGATATCCCGTTTGACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-1303s21c1
Sequence:CCGGTGATCAAGACGCACCAGATAGCTCGAGCTATCTGGTGCGTCTTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-1725s21c1
Sequence:CCGGCTGGATGGCAGTAGTACTAACCTCGAGGTTAGTACTACTGCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-525s21c1
Sequence:CCGGGCTCTTCTGTACTGCAACATTCTCGAGAATGTTGCAGTACAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-1128s21c1
Sequence:CCGGCGTTTGAAGAACAGCGACCTACTCGAGTAGGTCGCTGTTCTTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-2581s21c1
Sequence:CCGGCCGTAGTCTATTGGCTGCATACTCGAGTATGCAGCCAATAGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153420
VALIDATED
ACPL2 MISSION shRNA shRNA Plasmid DNA
acid phosphatase-like 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153420.1-2582s1c1
Sequence:CCGGCCGTAGTCTATTGGCTGCATACTCGAGTATGCAGCCAATAGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153420.1-526s1c1
Sequence:CCGGGCTCTTCTGTACTGCAACATTCTCGAGAATGTTGCAGTACAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153420.1-1578s1c1
Sequence:CCGGCAGTGAACATTCGGTCCGAATCTCGAGATTCGGACCGAATGTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153420.1-1129s1c1
Sequence:CCGGCGTTTGAAGAACAGCGACCTACTCGAGTAGGTCGCTGTTCTTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153420.1-1695s1c1
Sequence:CCGGCCGCTTTGTCAAACGGGATATCTCGAGATATCCCGTTTGACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-1303s21c1
Sequence:CCGGTGATCAAGACGCACCAGATAGCTCGAGCTATCTGGTGCGTCTTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-1725s21c1
Sequence:CCGGCTGGATGGCAGTAGTACTAACCTCGAGGTTAGTACTACTGCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-525s21c1
Sequence:CCGGGCTCTTCTGTACTGCAACATTCTCGAGAATGTTGCAGTACAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-1128s21c1
Sequence:CCGGCGTTTGAAGAACAGCGACCTACTCGAGTAGGTCGCTGTTCTTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-2581s21c1
Sequence:CCGGCCGTAGTCTATTGGCTGCATACTCGAGTATGCAGCCAATAGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153420
VALIDATED
ACPL2 MISSION shRNA Lentiviral Transduction Particles
acid phosphatase-like 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153420.1-2582s1c1
Sequence:CCGGCCGTAGTCTATTGGCTGCATACTCGAGTATGCAGCCAATAGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153420.1-526s1c1
Sequence:CCGGGCTCTTCTGTACTGCAACATTCTCGAGAATGTTGCAGTACAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153420.1-1578s1c1
Sequence:CCGGCAGTGAACATTCGGTCCGAATCTCGAGATTCGGACCGAATGTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153420.1-1129s1c1
Sequence:CCGGCGTTTGAAGAACAGCGACCTACTCGAGTAGGTCGCTGTTCTTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153420.1-1695s1c1
Sequence:CCGGCCGCTTTGTCAAACGGGATATCTCGAGATATCCCGTTTGACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-1303s21c1
Sequence:CCGGTGATCAAGACGCACCAGATAGCTCGAGCTATCTGGTGCGTCTTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-1725s21c1
Sequence:CCGGCTGGATGGCAGTAGTACTAACCTCGAGGTTAGTACTACTGCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-525s21c1
Sequence:CCGGGCTCTTCTGTACTGCAACATTCTCGAGAATGTTGCAGTACAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-1128s21c1
Sequence:CCGGCGTTTGAAGAACAGCGACCTACTCGAGTAGGTCGCTGTTCTTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153420.2-2581s21c1
Sequence:CCGGCCGTAGTCTATTGGCTGCATACTCGAGTATGCAGCCAATAGACTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152282
VALIDATED
ACPL2 MISSION shRNA Bacterial Glycerol Stock
acid phosphatase-like 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-582s1c1
Sequence:CCGGCCACTGTATGTCATTCCCAAACTCGAGTTTGGGAATGACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-397s1c1
Sequence:CCGGGTAGCAAGAGTCGAAAGAGAACTCGAGTTCTCTTTCGACTCTTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152282.2-1289s1c1
Sequence:CCGGGAAGAAATTGTACTTCGGGTACTCGAGTACCCGAAGTACAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-1479s1c1
Sequence:CCGGGCCAGGTTGATCTTTGAGCTTCTCGAGAAGCTCAAAGATCAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-1019s1c1
Sequence:CCGGCCCGGTAAGAAACCAGTATCTCTCGAGAGATACTGGTTTCTTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152282.3-1953s21c1
Sequence:GTACCGGAGAGGAATAGAAGGTACTTTACTCGAGTAAAGTACCTTCTATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-1040s21c1
Sequence:CCGGCCCGGTAAGAAACCAGTATCTCTCGAGAGATACTGGTTTCTTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152282.3-1819s21c1
Sequence:CCGGTACTAAGGGTAGAAGATTATTCTCGAGAATAATCTTCTACCCTTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-603s21c1
Sequence:CCGGCCACTGTATGTCATTCCCAAACTCGAGTTTGGGAATGACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-1310s21c1
Sequence:CCGGGAAGAAATTGTACTTCGGGTACTCGAGTACCCGAAGTACAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-418s21c1
Sequence:CCGGGTAGCAAGAGTCGAAAGAGAACTCGAGTTCTCTTTCGACTCTTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152282
VALIDATED
ACPL2 MISSION shRNA shRNA Plasmid DNA
acid phosphatase-like 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-582s1c1
Sequence:CCGGCCACTGTATGTCATTCCCAAACTCGAGTTTGGGAATGACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-397s1c1
Sequence:CCGGGTAGCAAGAGTCGAAAGAGAACTCGAGTTCTCTTTCGACTCTTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152282.2-1289s1c1
Sequence:CCGGGAAGAAATTGTACTTCGGGTACTCGAGTACCCGAAGTACAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-1479s1c1
Sequence:CCGGGCCAGGTTGATCTTTGAGCTTCTCGAGAAGCTCAAAGATCAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-1019s1c1
Sequence:CCGGCCCGGTAAGAAACCAGTATCTCTCGAGAGATACTGGTTTCTTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152282.3-1953s21c1
Sequence:GTACCGGAGAGGAATAGAAGGTACTTTACTCGAGTAAAGTACCTTCTATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-1040s21c1
Sequence:CCGGCCCGGTAAGAAACCAGTATCTCTCGAGAGATACTGGTTTCTTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152282.3-1819s21c1
Sequence:CCGGTACTAAGGGTAGAAGATTATTCTCGAGAATAATCTTCTACCCTTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-603s21c1
Sequence:CCGGCCACTGTATGTCATTCCCAAACTCGAGTTTGGGAATGACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-1310s21c1
Sequence:CCGGGAAGAAATTGTACTTCGGGTACTCGAGTACCCGAAGTACAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-418s21c1
Sequence:CCGGGTAGCAAGAGTCGAAAGAGAACTCGAGTTCTCTTTCGACTCTTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152282
VALIDATED
ACPL2 MISSION shRNA Lentiviral Transduction Particles
acid phosphatase-like 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-582s1c1
Sequence:CCGGCCACTGTATGTCATTCCCAAACTCGAGTTTGGGAATGACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-397s1c1
Sequence:CCGGGTAGCAAGAGTCGAAAGAGAACTCGAGTTCTCTTTCGACTCTTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152282.2-1289s1c1
Sequence:CCGGGAAGAAATTGTACTTCGGGTACTCGAGTACCCGAAGTACAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-1479s1c1
Sequence:CCGGGCCAGGTTGATCTTTGAGCTTCTCGAGAAGCTCAAAGATCAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152282.2-1019s1c1
Sequence:CCGGCCCGGTAAGAAACCAGTATCTCTCGAGAGATACTGGTTTCTTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380131    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152282.3-1953s21c1
Sequence:GTACCGGAGAGGAATAGAAGGTACTTTACTCGAGTAAAGTACCTTCTATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-1040s21c1
Sequence:CCGGCCCGGTAAGAAACCAGTATCTCTCGAGAGATACTGGTTTCTTACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152282.3-1819s21c1
Sequence:CCGGTACTAAGGGTAGAAGATTATTCTCGAGAATAATCTTCTACCCTTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-603s21c1
Sequence:CCGGCCACTGTATGTCATTCCCAAACTCGAGTTTGGGAATGACATACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-1310s21c1
Sequence:CCGGGAAGAAATTGTACTTCGGGTACTCGAGTACCCGAAGTACAATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152282.3-418s21c1
Sequence:CCGGGTAGCAAGAGTCGAAAGAGAACTCGAGTTCTCTTTCGACTCTTGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks