EMAIL THIS PAGE TO A FRIEND

ACPP

acid phosphatase, prostate

Synonyms: 5'-NT ACP-3 ACP3 PAP
UniProtKB ID: P15309, D3DNC6, Q96KY0, Q96QK9, Q96QM0
Gene ID:
Human(55) Summary: This gene encodes an enzyme that catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is synthesized under androgen regulation and is secreted by the epithelial cells of the prostate gland. An alternatively spliced transcript variant encoding a longer isoform has been found for this gene. This isoform contains a transmembrane domain and is localized in the plasma membrane-endosomal-lysosomal pathway. [provided by RefSeq, Sep 2008]
Mouse(56318) acid phosphatase, prostate
Rat(56780) acid phosphatase, prostate
domestic guinea pig(100719536) acid phosphatase, prostate
naked mole-rat(101711436) acid phosphatase, prostate
sheep(101120130) acid phosphatase, prostate
Domestic Rabbit(100352974) acid phosphatase, prostate
chicken(776390) acid phosphatase, prostate
cow(504700) acid phosphatase, prostate
Horse(100064835) acid phosphatase, prostate
domestic cat(101089640) acid phosphatase, prostate
dog(485662) acid phosphatase, prostate
198 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501687 Anti-ACPP antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2501605 Anti-ACPP antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1400002 Anti-ACPP antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA004335 Anti-ACPP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA063916 Anti-ACPP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2104826 Anti-ACPP antibody produced in rabbit affinity isolated antibody rat, human, horse, guinea pig, mouse, rabbit
western blot pricing
P5664 Anti-Prostatic Acid Phosphatase antibody produced in rabbit whole antiserum human
immunohistochemistry pricing
WH0000055M1 Monoclonal Anti-ACPP antibody produced in mouse clone 2D11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
P5687 Monoclonal Anti-Prostatic Acid Phosphatase, Human antibody produced in mouse clone PAP-12, ascites fluid human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099 Rosetta Predictions human pricing
NM_001134901 Rosetta Predictions rat pricing
NM_020072 Rosetta Predictions rat pricing
NM_019807 Rosetta Predictions mouse pricing
NM_207668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017484 predicted 1190
2 SASI_Hs02_00320194 predicted 1024
3 SASI_Hs01_00017485 predicted 413
4 SASI_Hs01_00017486 predicted 985
5 SASI_Hs02_00320195 predicted 594
6 SASI_Hs02_00320196 predicted 666
7 SASI_Hs02_00320197 predicted 911
8 SASI_Hs02_00320198 predicted 1222
9 SASI_Hs01_00017488 predicted 732
10 SASI_Hs01_00017487 predicted 903
11 SASI_Hs01_00017489 predicted 1178
12 SASI_Hs01_00017490 predicted 331
13 SASI_Hs01_00017491 predicted 977
14 SASI_Hs01_00017492 predicted 676
15 SASI_Hs01_00017493 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259004 predicted 210
2 SASI_Rn02_00259005 predicted 247
3 SASI_Rn02_00259006 predicted 225
4 SASI_Rn02_00259007 predicted 259
5 SASI_Rn02_00259008 predicted 231
6 SASI_Rn02_00259009 predicted 249
7 SASI_Rn02_00259010 predicted 284
8 SASI_Rn02_00259011 predicted 226
9 SASI_Rn02_00259012 predicted 234
10 SASI_Rn02_00259013 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262448 predicted 251
2 SASI_Rn02_00262449 predicted 293
3 SASI_Rn01_00114384 predicted 270
4 SASI_Rn02_00262450 predicted 298
5 SASI_Rn02_00262451 predicted 271
6 SASI_Rn02_00262452 predicted 293
7 SASI_Rn02_00262453 predicted 317
8 SASI_Rn02_00262454 predicted 268
9 SASI_Rn02_00262455 predicted 272
10 SASI_Rn02_00262456 predicted 300
11 SASI_Rn01_00114379 predicted 987
12 SASI_Rn01_00114380 predicted 659
13 SASI_Rn01_00114381 predicted 769
14 SASI_Rn01_00114382 predicted 756
15 SASI_Rn01_00114383 predicted 570
16 SASI_Rn01_00114385 predicted 667
17 SASI_Rn01_00114386 predicted 1267
18 SASI_Rn01_00114387 predicted 845
19 SASI_Rn01_00114388 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325068 predicted 753
2 SASI_Mm01_00160188 predicted 319
3 SASI_Mm01_00160189 predicted 278
4 SASI_Mm01_00160190 predicted 783
5 SASI_Mm01_00160191 predicted 339
6 SASI_Mm02_00325069 predicted 372
7 SASI_Mm01_00160193 predicted 788
8 SASI_Mm01_00160194 predicted 286
9 SASI_Mm01_00160195 predicted 388
10 SASI_Mm01_00160196 predicted 685
11 SASI_Mm01_00160192 predicted 379
12 SASI_Mm01_00160197 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352196 predicted 757
2 SASI_Mm01_00138922 predicted 320
3 SASI_Mm01_00138923 predicted 275
4 SASI_Mm01_00138924 predicted 784
5 SASI_Mm01_00138925 predicted 343
6 SASI_Mm02_00352197 predicted 373
7 SASI_Mm01_00138927 predicted 785
8 SASI_Mm01_00138928 predicted 287
9 SASI_Mm01_00138929 predicted 390
10 SASI_Mm01_00138930 predicted 688
11 SASI_Mm01_00138926 predicted 374
12 SASI_Mm01_00138931 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019807
VALIDATED
ACPP MISSION shRNA Bacterial Glycerol Stock
acid phosphatase, prostate
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019807.2-1569s21c1
Sequence:CCGCCAAGGCGCGTTGTAGTCAATACTCGAGTATTGACTACAACGCGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019807.2-780s21c1
Sequence:CCGGATTATCTCTGCTATCACTTTACTCGAGTAAAGTGATAGCAGAGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019807.2-594s21c1
Sequence:CCGGGAAGAGGCTTCATCCATATAACTCGAGTTATATGGATGAAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019807.2-333s21c1
Sequence:CCGGATTCTTGAACGACACCTATAACTCGAGTTATAGGTGTCGTTCAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019807.2-1965s1c1
Sequence:CCGGCCTGGGATTCTAAATTGGATACTCGAGTATCCAATTTAGAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019807.2-390s1c1
Sequence:CCGGCAGGACTTTGATGAGTGCTATCTCGAGATAGCACTCATCAAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019807.2-292s1c1
Sequence:CCGGCACTACGAACTTGGAAGTTATCTCGAGATAACTTCCAAGTTCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019807.2-694s1c1
Sequence:CCGGCCTTTATTCTGCGAGAGTGTTCTCGAGAACACTCTCGCAGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019807.2-748s1c1
Sequence:CCGGGACGCCATGATTAAGTTGAAACTCGAGTTTCAACTTAATCATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019807
VALIDATED
ACPP MISSION shRNA shRNA Plasmid DNA
acid phosphatase, prostate
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019807.2-1569s21c1
Sequence:CCGCCAAGGCGCGTTGTAGTCAATACTCGAGTATTGACTACAACGCGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019807.2-780s21c1
Sequence:CCGGATTATCTCTGCTATCACTTTACTCGAGTAAAGTGATAGCAGAGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019807.2-594s21c1
Sequence:CCGGGAAGAGGCTTCATCCATATAACTCGAGTTATATGGATGAAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019807.2-333s21c1
Sequence:CCGGATTCTTGAACGACACCTATAACTCGAGTTATAGGTGTCGTTCAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019807.2-1965s1c1
Sequence:CCGGCCTGGGATTCTAAATTGGATACTCGAGTATCCAATTTAGAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019807.2-390s1c1
Sequence:CCGGCAGGACTTTGATGAGTGCTATCTCGAGATAGCACTCATCAAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019807.2-292s1c1
Sequence:CCGGCACTACGAACTTGGAAGTTATCTCGAGATAACTTCCAAGTTCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019807.2-694s1c1
Sequence:CCGGCCTTTATTCTGCGAGAGTGTTCTCGAGAACACTCTCGCAGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019807.2-748s1c1
Sequence:CCGGGACGCCATGATTAAGTTGAAACTCGAGTTTCAACTTAATCATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019807
VALIDATED
ACPP MISSION shRNA Lentiviral Transduction Particles
acid phosphatase, prostate
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019807.2-1569s21c1
Sequence:CCGCCAAGGCGCGTTGTAGTCAATACTCGAGTATTGACTACAACGCGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019807.2-780s21c1
Sequence:CCGGATTATCTCTGCTATCACTTTACTCGAGTAAAGTGATAGCAGAGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019807.2-594s21c1
Sequence:CCGGGAAGAGGCTTCATCCATATAACTCGAGTTATATGGATGAAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019807.2-333s21c1
Sequence:CCGGATTCTTGAACGACACCTATAACTCGAGTTATAGGTGTCGTTCAAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019807.2-1965s1c1
Sequence:CCGGCCTGGGATTCTAAATTGGATACTCGAGTATCCAATTTAGAATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019807.2-390s1c1
Sequence:CCGGCAGGACTTTGATGAGTGCTATCTCGAGATAGCACTCATCAAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019807.2-292s1c1
Sequence:CCGGCACTACGAACTTGGAAGTTATCTCGAGATAACTTCCAAGTTCGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019807.2-694s1c1
Sequence:CCGGCCTTTATTCTGCGAGAGTGTTCTCGAGAACACTCTCGCAGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019807.2-748s1c1
Sequence:CCGGGACGCCATGATTAAGTTGAAACTCGAGTTTCAACTTAATCATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099
ACPP MISSION shRNA Bacterial Glycerol Stock
acid phosphatase, prostate
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099.4-365s21c1
Sequence:CCGGTCTTGAATGAGTCCTATAAACCTCGAGGTTTATAGGACTCATTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099.4-325s21c1
Sequence:CCGGTATGAACTTGGAGAGTATATACTCGAGTATATACTCTCCAAGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099.4-1599s21c1
Sequence:CCGGTGCTTGAGCAGGATTAGATAACTCGAGTTATCTAATCCTGCTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099.4-623s21c1
Sequence:CCGGAGAAGAGGCTGCACCCTTATACTCGAGTATAAGGGTGCAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-154s1c1
Sequence:CCGGGTGACTTTGGTGTTTCGGCATCTCGAGATGCCGAAACACCAAAGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-723s1c1
Sequence:CCGGCACTGAGGACACCATGACTAACTCGAGTTAGTCATGGTGTCCTCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-987s1c1
Sequence:CCGGGACGGAATTGTACTTTGAGAACTCGAGTTCTCAAAGTACAATTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001099.x-2662s1c1
Sequence:CCGGGAAATACGTTAGGAGGACAAACTCGAGTTTGTCCTCCTAACGTATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-865s1c1
Sequence:CCGGACTCAGATACCAAGCTACAAACTCGAGTTTGTAGCTTGGTATCTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099
ACPP MISSION shRNA shRNA Plasmid DNA
acid phosphatase, prostate
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099.4-365s21c1
Sequence:CCGGTCTTGAATGAGTCCTATAAACCTCGAGGTTTATAGGACTCATTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099.4-325s21c1
Sequence:CCGGTATGAACTTGGAGAGTATATACTCGAGTATATACTCTCCAAGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099.4-1599s21c1
Sequence:CCGGTGCTTGAGCAGGATTAGATAACTCGAGTTATCTAATCCTGCTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099.4-623s21c1
Sequence:CCGGAGAAGAGGCTGCACCCTTATACTCGAGTATAAGGGTGCAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-154s1c1
Sequence:CCGGGTGACTTTGGTGTTTCGGCATCTCGAGATGCCGAAACACCAAAGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-723s1c1
Sequence:CCGGCACTGAGGACACCATGACTAACTCGAGTTAGTCATGGTGTCCTCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-987s1c1
Sequence:CCGGGACGGAATTGTACTTTGAGAACTCGAGTTCTCAAAGTACAATTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001099.x-2662s1c1
Sequence:CCGGGAAATACGTTAGGAGGACAAACTCGAGTTTGTCCTCCTAACGTATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-865s1c1
Sequence:CCGGACTCAGATACCAAGCTACAAACTCGAGTTTGTAGCTTGGTATCTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099
ACPP MISSION shRNA Lentiviral Transduction Particles
acid phosphatase, prostate
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099.4-365s21c1
Sequence:CCGGTCTTGAATGAGTCCTATAAACCTCGAGGTTTATAGGACTCATTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099.4-325s21c1
Sequence:CCGGTATGAACTTGGAGAGTATATACTCGAGTATATACTCTCCAAGTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099.4-1599s21c1
Sequence:CCGGTGCTTGAGCAGGATTAGATAACTCGAGTTATCTAATCCTGCTCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099.4-623s21c1
Sequence:CCGGAGAAGAGGCTGCACCCTTATACTCGAGTATAAGGGTGCAGCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-154s1c1
Sequence:CCGGGTGACTTTGGTGTTTCGGCATCTCGAGATGCCGAAACACCAAAGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-723s1c1
Sequence:CCGGCACTGAGGACACCATGACTAACTCGAGTTAGTCATGGTGTCCTCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-987s1c1
Sequence:CCGGGACGGAATTGTACTTTGAGAACTCGAGTTCTCAAAGTACAATTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001099.x-2662s1c1
Sequence:CCGGGAAATACGTTAGGAGGACAAACTCGAGTTTGTCCTCCTAACGTATTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001099.x-865s1c1
Sequence:CCGGACTCAGATACCAAGCTACAAACTCGAGTTTGTAGCTTGGTATCTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks