EMAIL THIS PAGE TO A FRIEND

ACPT

acid phosphatase, testicular

78 Gene Product Result for
UniProtKB ID: Q9BZG2, C0H3P7, Q9BZG3, Q9BZG4
Gene ID:
Human(93650) Summary: Acid phosphatases are enzymes capable of hydrolyzing orthophosphoric acid esters in an acid medium. This gene is up-regulated by androgens and is down-regulated by estrogens in the prostate cancer cell line. This gene exhibits a lower level of expression in testicular cancer tissues than in normal tissues. The protein encoded by this gene has structural similarity to prostatic and lysosomal acid phosphatases. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(100503991) acid phosphatase, testicular
Rat(308569) acid phosphatase, testicular
domestic cat(101087626) acid phosphatase, testicular
cow(788015) acid phosphatase, testicular
dog(484357) acid phosphatase, testicular
sheep(101119583) acid phosphatase, testicular
naked mole-rat(101719581) acid phosphatase, testicular
domestic guinea pig(100717531) acid phosphatase, testicular
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080789 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033068 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152181 MISSION® esiRNA esiRNA human ACPT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033068 Rosetta Predictions human pricing
NM_080789 Rosetta Predictions human pricing
NM_080790 Rosetta Predictions human pricing
NM_080791 Rosetta Predictions human pricing
NM_001107510 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120060 predicted 970
2 SASI_Hs02_00360768 predicted 572
3 SASI_Hs01_00120053 predicted 977
4 SASI_Hs02_00360769 predicted 701
5 SASI_Hs02_00360770 predicted 697
6 SASI_Hs02_00360771 predicted 698
7 SASI_Hs01_00120055 predicted 994
8 SASI_Hs02_00360772 predicted 700
9 SASI_Hs02_00360773 predicted 607
10 SASI_Hs02_00360774 predicted 678
11 SASI_Hs01_00120052 predicted 993
12 SASI_Hs01_00120054 predicted 1081
13 SASI_Hs01_00120056 predicted 1004
14 SASI_Hs01_00120057 predicted 1075
15 SASI_Hs01_00120058 predicted 982
16 SASI_Hs01_00120059 predicted 1004
17 SASI_Hs01_00120061 predicted 99
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235216 predicted 645
2 SASI_Hs01_00235217 predicted 777
3 SASI_Hs01_00235218 predicted 767
4 SASI_Hs01_00235219 predicted 768
5 SASI_Hs01_00235220 predicted 778
6 SASI_Hs01_00235221 predicted 683
7 SASI_Hs01_00235222 predicted 748
8 SASI_Hs01_00235223 predicted 1036
9 SASI_Hs01_00235224 predicted 1050
10 SASI_Hs01_00235225 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120462 predicted 718
2 SASI_Hs01_00120463 predicted 645
3 SASI_Hs01_00120464 predicted 699
4 SASI_Hs01_00120465 predicted 713
5 SASI_Hs01_00120466 predicted 416
6 SASI_Hs01_00120467 predicted 720
7 SASI_Hs01_00120468 predicted 910
8 SASI_Hs01_00120469 predicted 777
9 SASI_Hs01_00120470 predicted 920
10 SASI_Hs01_00120471 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029538 predicted 715
2 SASI_Hs01_00029539 predicted 708
3 SASI_Hs01_00029540 predicted 802
4 SASI_Hs01_00029541 predicted 720
5 SASI_Hs01_00029542 predicted 724
6 SASI_Hs01_00029543 predicted 797
7 SASI_Hs01_00029544 predicted 703
8 SASI_Hs01_00029545 predicted 720
9 SASI_Hs01_00029546 predicted 697
10 SASI_Hs01_00029547 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229535 predicted 500
2 SASI_Rn02_00229536 predicted 591
3 SASI_Rn02_00229537 predicted 571
4 SASI_Rn02_00229538 predicted 601
5 SASI_Rn02_00229539 predicted 880
6 SASI_Rn02_00229540 predicted 814
7 SASI_Rn02_00229541 predicted 378
8 SASI_Rn02_00229542 predicted 547
9 SASI_Rn02_00229543 predicted 379
10 SASI_Rn02_00229544 predicted 526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080789
ACPT MISSION shRNA Bacterial Glycerol Stock
acid phosphatase, testicular
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000052673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-153s1c1
Sequence:CCGGGCTAGCCCTGACCAGTCCTGTCTCGAGACAGGACTGGTCAGGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-226s1c1
Sequence:CCGGACCCACACAAGGAGGTGGCCTCTCGAGAGGCCACCTCCTTGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-148s1c1
Sequence:CCGGCCAGGGCTAGCCCTGACCAGTCTCGAGACTGGTCAGGGCTAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-27s1c1
Sequence:CCGGCCCTGCTGGACCTCTCCTGCTCTCGAGAGCAGGAGAGGTCCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080789
ACPT MISSION shRNA shRNA Plasmid DNA
acid phosphatase, testicular
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000052673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-153s1c1
Sequence:CCGGGCTAGCCCTGACCAGTCCTGTCTCGAGACAGGACTGGTCAGGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-226s1c1
Sequence:CCGGACCCACACAAGGAGGTGGCCTCTCGAGAGGCCACCTCCTTGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-148s1c1
Sequence:CCGGCCAGGGCTAGCCCTGACCAGTCTCGAGACTGGTCAGGGCTAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-27s1c1
Sequence:CCGGCCCTGCTGGACCTCTCCTGCTCTCGAGAGCAGGAGAGGTCCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080789
ACPT MISSION shRNA Lentiviral Transduction Particles
acid phosphatase, testicular
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000052673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-153s1c1
Sequence:CCGGGCTAGCCCTGACCAGTCCTGTCTCGAGACAGGACTGGTCAGGGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-226s1c1
Sequence:CCGGACCCACACAAGGAGGTGGCCTCTCGAGAGGCCACCTCCTTGTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-148s1c1
Sequence:CCGGCCAGGGCTAGCCCTGACCAGTCTCGAGACTGGTCAGGGCTAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080789.1-27s1c1
Sequence:CCGGCCCTGCTGGACCTCTCCTGCTCTCGAGAGCAGGAGAGGTCCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033068
ACPT MISSION shRNA Bacterial Glycerol Stock
acid phosphatase, testicular
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-925s21c1
Sequence:GTACCGGTATGCTGCCTGCCTCGGCTTTCTCGAGAAAGCCGAGGCAGGCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-707s21c1
Sequence:GTACCGGAGATCTCGGCTTTGGATATTGCTCGAGCAATATCCAAAGCCGAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-682s21c1
Sequence:GTACCGGCCAGATGTCCTGCGGACTCTTCTCGAGAAGAGTCCGCAGGACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-973s21c1
Sequence:GTACCGGGCCAAAGATGGAGGGAATGTCCTCGAGGACATTCCCTCCATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-574s21c1
Sequence:GTACCGGTTCACGGGACTGTCGCTGGTTCTCGAGAACCAGCGACAGTCCCGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-308s21c1
Sequence:GTACCGGACATCCGCAGCACGGACTTTGCTCGAGCAAAGTCCGTGCTGCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-97s21c1
Sequence:GTACCGGGTGTTCGTGGCTCTGGTATTCCTCGAGGAATACCAGAGCCACGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-782s21c1
Sequence:GTACCGGTCCTGCTGAATGCTATCCTTGCTCGAGCAAGGATAGCATTCAGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033068
ACPT MISSION shRNA shRNA Plasmid DNA
acid phosphatase, testicular
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-925s21c1
Sequence:GTACCGGTATGCTGCCTGCCTCGGCTTTCTCGAGAAAGCCGAGGCAGGCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-707s21c1
Sequence:GTACCGGAGATCTCGGCTTTGGATATTGCTCGAGCAATATCCAAAGCCGAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-682s21c1
Sequence:GTACCGGCCAGATGTCCTGCGGACTCTTCTCGAGAAGAGTCCGCAGGACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-973s21c1
Sequence:GTACCGGGCCAAAGATGGAGGGAATGTCCTCGAGGACATTCCCTCCATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-574s21c1
Sequence:GTACCGGTTCACGGGACTGTCGCTGGTTCTCGAGAACCAGCGACAGTCCCGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-308s21c1
Sequence:GTACCGGACATCCGCAGCACGGACTTTGCTCGAGCAAAGTCCGTGCTGCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-97s21c1
Sequence:GTACCGGGTGTTCGTGGCTCTGGTATTCCTCGAGGAATACCAGAGCCACGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-782s21c1
Sequence:GTACCGGTCCTGCTGAATGCTATCCTTGCTCGAGCAAGGATAGCATTCAGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033068
ACPT MISSION shRNA Lentiviral Transduction Particles
acid phosphatase, testicular
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-925s21c1
Sequence:GTACCGGTATGCTGCCTGCCTCGGCTTTCTCGAGAAAGCCGAGGCAGGCAGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-707s21c1
Sequence:GTACCGGAGATCTCGGCTTTGGATATTGCTCGAGCAATATCCAAAGCCGAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-682s21c1
Sequence:GTACCGGCCAGATGTCCTGCGGACTCTTCTCGAGAAGAGTCCGCAGGACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-973s21c1
Sequence:GTACCGGGCCAAAGATGGAGGGAATGTCCTCGAGGACATTCCCTCCATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-574s21c1
Sequence:GTACCGGTTCACGGGACTGTCGCTGGTTCTCGAGAACCAGCGACAGTCCCGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-308s21c1
Sequence:GTACCGGACATCCGCAGCACGGACTTTGCTCGAGCAAAGTCCGTGCTGCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-97s21c1
Sequence:GTACCGGGTGTTCGTGGCTCTGGTATTCCTCGAGGAATACCAGAGCCACGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033068.2-782s21c1
Sequence:GTACCGGTCCTGCTGAATGCTATCCTTGCTCGAGCAAGGATAGCATTCAGCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks