EMAIL THIS PAGE TO A FRIEND

ACR

acrosin

55 Gene Product Result for
UniProtKB ID: P10323, Q6ICK2
Gene ID:
Human(49) Summary: Acrosin is the major proteinase present in the acrosome of mature spermatozoa. It is a typical serine proteinase with trypsin-like specificity. It is stored in the acrosome in its precursor form, proacrosin. The active enzyme functions in the lysis of the zona pellucida, thus facilitating penetration of the sperm through the innermost glycoprotein layers of the ovum. The mRNA for proacrosin is synthesized only in the postmeiotic stages of spermatogenesis. In humans proacrosin first appears in the haploid spermatids. [provided by RefSeq, Jul 2008]
Mouse(11434) acrosin prepropeptide
Rat(24163) acrosin
chicken(426864) acrosin
cow(280711) acrosin
dog(606765) acrosin
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097 Rosetta Predictions human pricing
NM_012490 Rosetta Predictions rat pricing
NM_013455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113297 predicted 608
2 SASI_Hs01_00113298 predicted 769
3 SASI_Hs01_00113299 predicted 199
4 SASI_Hs01_00113300 predicted 764
5 SASI_Hs01_00113301 predicted 763
6 SASI_Hs02_00318219 predicted 360
7 SASI_Hs01_00113302 predicted 628
8 SASI_Hs01_00113303 predicted 645
9 SASI_Hs01_00113304 predicted 664
10 SASI_Hs01_00113305 predicted 431
11 SASI_Hs01_00113306 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259517 predicted 635
2 SASI_Rn02_00259518 predicted 1065
3 SASI_Rn01_00047036 predicted 1104
4 SASI_Rn02_00259519 predicted 1119
5 SASI_Rn01_00047041 predicted 938
6 SASI_Rn01_00047042 predicted 682
7 SASI_Rn02_00259520 predicted 675
8 SASI_Rn02_00259521 predicted 661
9 SASI_Rn02_00259522 predicted 969
10 SASI_Rn02_00259523 predicted 824
11 SASI_Rn01_00047034 predicted 950
12 SASI_Rn01_00047035 predicted 349
13 SASI_Rn01_00047037 predicted 433
14 SASI_Rn01_00047038 predicted 284
15 SASI_Rn01_00047039 predicted 716
16 SASI_Rn01_00047040 predicted 620
17 SASI_Rn01_00047043 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192376 predicted 637
2 SASI_Mm01_00192377 predicted 903
3 SASI_Mm01_00192380 predicted 1079
4 SASI_Mm01_00192381 predicted 1027
5 SASI_Mm02_00322047 predicted 1135
6 SASI_Mm02_00322048 predicted 1135
7 SASI_Mm02_00322049 predicted 662
8 SASI_Mm02_00322050 predicted 1131
9 SASI_Mm01_00192383 predicted 943
10 SASI_Mm01_00192384 predicted 982
11 SASI_Mm01_00192375 predicted 685
12 SASI_Mm01_00192378 predicted 622
13 SASI_Mm01_00192379 predicted 733
14 SASI_Mm01_00192382 predicted 810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013455
ACR MISSION shRNA Bacterial Glycerol Stock
acrosin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013455.2-449s21c1
Sequence:CCGGTGACGGAGGGAAATGACATTGCTCGAGCAATGTCATTTCCCTCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013455.2-1227s21c1
Sequence:CCCGGATGAGAACTTACCCTATGAACTCGAGTTCATAGGGTAAGTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013455.2-688s21c1
Sequence:CCGGGGGCGTGTCACATCGACTAATCTCGAGATTAGTCGATGTGACACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-262s1c1
Sequence:CCGGGCCCACTGCTTCGATAACAAACTCGAGTTTGTTATCGAAGCAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-363s1c1
Sequence:CCGGGCAGGAGAGATATGTGCAGAACTCGAGTTCTGCACATATCTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-1134s1c1
Sequence:CCGGGCACCGCACAACGCTGTCTTTCTCGAGAAAGACAGCGTTGTGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-874s1c1
Sequence:CCGGCCTAACGCCTTGCACTTGATTCTCGAGAATCAAGTGCAAGGCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-997s1c1
Sequence:CCGGCCGCTTTACCTGCGACCACTACTCGAGTAGTGGTCGCAGGTAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013455
ACR MISSION shRNA shRNA Plasmid DNA
acrosin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013455.2-449s21c1
Sequence:CCGGTGACGGAGGGAAATGACATTGCTCGAGCAATGTCATTTCCCTCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013455.2-1227s21c1
Sequence:CCCGGATGAGAACTTACCCTATGAACTCGAGTTCATAGGGTAAGTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013455.2-688s21c1
Sequence:CCGGGGGCGTGTCACATCGACTAATCTCGAGATTAGTCGATGTGACACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-262s1c1
Sequence:CCGGGCCCACTGCTTCGATAACAAACTCGAGTTTGTTATCGAAGCAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-363s1c1
Sequence:CCGGGCAGGAGAGATATGTGCAGAACTCGAGTTCTGCACATATCTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-1134s1c1
Sequence:CCGGGCACCGCACAACGCTGTCTTTCTCGAGAAAGACAGCGTTGTGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-874s1c1
Sequence:CCGGCCTAACGCCTTGCACTTGATTCTCGAGAATCAAGTGCAAGGCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-997s1c1
Sequence:CCGGCCGCTTTACCTGCGACCACTACTCGAGTAGTGGTCGCAGGTAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013455
ACR MISSION shRNA Lentiviral Transduction Particles
acrosin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013455.2-449s21c1
Sequence:CCGGTGACGGAGGGAAATGACATTGCTCGAGCAATGTCATTTCCCTCCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013455.2-1227s21c1
Sequence:CCCGGATGAGAACTTACCCTATGAACTCGAGTTCATAGGGTAAGTTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013455.2-688s21c1
Sequence:CCGGGGGCGTGTCACATCGACTAATCTCGAGATTAGTCGATGTGACACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-262s1c1
Sequence:CCGGGCCCACTGCTTCGATAACAAACTCGAGTTTGTTATCGAAGCAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-363s1c1
Sequence:CCGGGCAGGAGAGATATGTGCAGAACTCGAGTTCTGCACATATCTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-1134s1c1
Sequence:CCGGGCACCGCACAACGCTGTCTTTCTCGAGAAAGACAGCGTTGTGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-874s1c1
Sequence:CCGGCCTAACGCCTTGCACTTGATTCTCGAGAATCAAGTGCAAGGCGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013455.1-997s1c1
Sequence:CCGGCCGCTTTACCTGCGACCACTACTCGAGTAGTGGTCGCAGGTAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097
ACR MISSION shRNA Bacterial Glycerol Stock
acrosin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097.2-98s21c1
Sequence:CCGGGTGGGTTACGGTTCAGGCAAACTCGAGTTTGCCTGAACCGTAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097.2-248s21c1
Sequence:CCGGATTCACGATGGGTGCTCACTGCTCGAGCAGTGAGCACCCATCGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097.2-182s21c1
Sequence:CCGGTGGTCAGCCTCCAGATCTTCACTCGAGTGAAGATCTGGAGGCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-376s1c1
Sequence:CCGGGCAAGAGAGATATGTGGAGAACTCGAGTTCTCCACATATCTCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-425s1c1
Sequence:CCGGGCGACAGAGGGAAATGACATTCTCGAGAATGTCATTTCCCTCTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-275s1c1
Sequence:CCGGGCTCACTGCTTCGTCGGCAAACTCGAGTTTGCCGACGAAGCAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-60s1c1
Sequence:CCGGTGTCCGTGGTTGCTAAAGATACTCGAGTATCTTTAGCAACCACGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-871s1c1
Sequence:CCGGCGCCTCCAAGATTGGTTCTAACTCGAGTTAGAACCAATCTTGGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097
ACR MISSION shRNA shRNA Plasmid DNA
acrosin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097.2-98s21c1
Sequence:CCGGGTGGGTTACGGTTCAGGCAAACTCGAGTTTGCCTGAACCGTAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097.2-248s21c1
Sequence:CCGGATTCACGATGGGTGCTCACTGCTCGAGCAGTGAGCACCCATCGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097.2-182s21c1
Sequence:CCGGTGGTCAGCCTCCAGATCTTCACTCGAGTGAAGATCTGGAGGCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-376s1c1
Sequence:CCGGGCAAGAGAGATATGTGGAGAACTCGAGTTCTCCACATATCTCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-425s1c1
Sequence:CCGGGCGACAGAGGGAAATGACATTCTCGAGAATGTCATTTCCCTCTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-275s1c1
Sequence:CCGGGCTCACTGCTTCGTCGGCAAACTCGAGTTTGCCGACGAAGCAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-60s1c1
Sequence:CCGGTGTCCGTGGTTGCTAAAGATACTCGAGTATCTTTAGCAACCACGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-871s1c1
Sequence:CCGGCGCCTCCAAGATTGGTTCTAACTCGAGTTAGAACCAATCTTGGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097
ACR MISSION shRNA Lentiviral Transduction Particles
acrosin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097.2-98s21c1
Sequence:CCGGGTGGGTTACGGTTCAGGCAAACTCGAGTTTGCCTGAACCGTAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097.2-248s21c1
Sequence:CCGGATTCACGATGGGTGCTCACTGCTCGAGCAGTGAGCACCCATCGTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097.2-182s21c1
Sequence:CCGGTGGTCAGCCTCCAGATCTTCACTCGAGTGAAGATCTGGAGGCTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-376s1c1
Sequence:CCGGGCAAGAGAGATATGTGGAGAACTCGAGTTCTCCACATATCTCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-425s1c1
Sequence:CCGGGCGACAGAGGGAAATGACATTCTCGAGAATGTCATTTCCCTCTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-275s1c1
Sequence:CCGGGCTCACTGCTTCGTCGGCAAACTCGAGTTTGCCGACGAAGCAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-60s1c1
Sequence:CCGGTGTCCGTGGTTGCTAAAGATACTCGAGTATCTTTAGCAACCACGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001097.1-871s1c1
Sequence:CCGGCGCCTCCAAGATTGGTTCTAACTCGAGTTAGAACCAATCTTGGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks