EMAIL THIS PAGE TO A FRIEND

ACRC

acidic repeat containing

27 Gene Product Result for
Synonyms: NAAR1
UniProtKB ID: Q96QF7, B9EG62
Gene ID:
Zebrafish(541448) acidic repeat containing
cow(526702) acidic repeat containing
domestic cat(101080619) acidic repeat containing
dog(491951) acidic repeat containing
chicken(422202) acidic repeat containing
sheep(101101959) acidic repeat containing
naked mole-rat(101705925) acidic repeat containing
domestic guinea pig(101788403) acidic repeat containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052957 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052957 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161919 predicted 2002
2 SASI_Hs01_00161920 predicted 1677
3 SASI_Hs01_00161921 predicted 2281
4 SASI_Hs01_00161922 predicted 1118
5 SASI_Hs02_00361760 predicted 1660
6 SASI_Hs02_00361761 predicted 497
7 SASI_Hs01_00161923 predicted 1686
8 SASI_Hs01_00161924 predicted 1090
9 SASI_Hs01_00161925 predicted 1257
10 SASI_Hs01_00161926 predicted 1816
11 SASI_Hs01_00161927 predicted 653
12 SASI_Hs01_00161928 predicted 1971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052957
ACRC MISSION shRNA Bacterial Glycerol Stock
acidic repeat containing
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052957.4-2329s21c1
Sequence:CCGGGGTGACGCATGGAAGTATTATCTCGAGATAATACTTCCATGCGTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052957.4-2262s21c1
Sequence:CCGGGGATACCTTGATCCATGAAATCTCGAGATTTCATGGATCAAGGTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052957.4-2716s21c1
Sequence:CCGGTAATGTGAGCTATATCCTTTACTCGAGTAAAGGATATAGCTCACATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052957.4-2881s21c1
Sequence:CCGGGTGCCCTTGACAGGGTATTTCCTCGAGGAAATACCCTGTCAAGGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052957.4-2836s21c1
Sequence:CCGGTAACGATGATTGACCTTAAATCTCGAGATTTAAGGTCAATCATCGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052957.4-2392s21c1
Sequence:CCGGACCCGTTGCCATAACTATAAGCTCGAGCTTATAGTTATGGCAACGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052957.2-470s1c1
Sequence:CCGGCCTCCAATAGTTATTAGTGATCTCGAGATCACTAATAACTATTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052957.2-166s1c1
Sequence:CCGGCGAGGATTGTTACATCCTTAACTCGAGTTAAGGATGTAACAATCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052957.2-2198s1c1
Sequence:CCGGGCTGTGTATGTGCAGAAGTATCTCGAGATACTTCTGCACATACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052957.2-500s1c1
Sequence:CCGGGACGATGACAACGGTAATGATCTCGAGATCATTACCGTTGTCATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052957
ACRC MISSION shRNA shRNA Plasmid DNA
acidic repeat containing
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052957.4-2329s21c1
Sequence:CCGGGGTGACGCATGGAAGTATTATCTCGAGATAATACTTCCATGCGTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052957.4-2262s21c1
Sequence:CCGGGGATACCTTGATCCATGAAATCTCGAGATTTCATGGATCAAGGTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052957.4-2716s21c1
Sequence:CCGGTAATGTGAGCTATATCCTTTACTCGAGTAAAGGATATAGCTCACATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052957.4-2881s21c1
Sequence:CCGGGTGCCCTTGACAGGGTATTTCCTCGAGGAAATACCCTGTCAAGGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052957.4-2836s21c1
Sequence:CCGGTAACGATGATTGACCTTAAATCTCGAGATTTAAGGTCAATCATCGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052957.4-2392s21c1
Sequence:CCGGACCCGTTGCCATAACTATAAGCTCGAGCTTATAGTTATGGCAACGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052957.2-470s1c1
Sequence:CCGGCCTCCAATAGTTATTAGTGATCTCGAGATCACTAATAACTATTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052957.2-166s1c1
Sequence:CCGGCGAGGATTGTTACATCCTTAACTCGAGTTAAGGATGTAACAATCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052957.2-2198s1c1
Sequence:CCGGGCTGTGTATGTGCAGAAGTATCTCGAGATACTTCTGCACATACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052957.2-500s1c1
Sequence:CCGGGACGATGACAACGGTAATGATCTCGAGATCATTACCGTTGTCATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052957
ACRC MISSION shRNA Lentiviral Transduction Particles
acidic repeat containing
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052957.4-2329s21c1
Sequence:CCGGGGTGACGCATGGAAGTATTATCTCGAGATAATACTTCCATGCGTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052957.4-2262s21c1
Sequence:CCGGGGATACCTTGATCCATGAAATCTCGAGATTTCATGGATCAAGGTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052957.4-2716s21c1
Sequence:CCGGTAATGTGAGCTATATCCTTTACTCGAGTAAAGGATATAGCTCACATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052957.4-2881s21c1
Sequence:CCGGGTGCCCTTGACAGGGTATTTCCTCGAGGAAATACCCTGTCAAGGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052957.4-2836s21c1
Sequence:CCGGTAACGATGATTGACCTTAAATCTCGAGATTTAAGGTCAATCATCGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052957.4-2392s21c1
Sequence:CCGGACCCGTTGCCATAACTATAAGCTCGAGCTTATAGTTATGGCAACGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052957.2-470s1c1
Sequence:CCGGCCTCCAATAGTTATTAGTGATCTCGAGATCACTAATAACTATTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052957.2-166s1c1
Sequence:CCGGCGAGGATTGTTACATCCTTAACTCGAGTTAAGGATGTAACAATCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168719    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052957.2-2198s1c1
Sequence:CCGGGCTGTGTATGTGCAGAAGTATCTCGAGATACTTCTGCACATACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052957.2-500s1c1
Sequence:CCGGGACGATGACAACGGTAATGATCTCGAGATCATTACCGTTGTCATCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)