EMAIL THIS PAGE TO A FRIEND

ACRV1

acrosomal vesicle protein 1

168 Gene Product Result for
Synonyms: D11S4365 SP-10 SPACA2
UniProtKB ID: P26436, Q53FF4
Gene ID:
Human(56) Summary: This gene encodes a testis-specific, differentiation antigen, acrosomal vesicle protein 1, that arises within the acrosomal vesicle during spermatogenesis, and is associated with the acrosomal membranes and matrix of mature sperm. The acrosomal vesicle protein 1 may be involved in sperm-zona binding or penetration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Mouse(11451) acrosomal vesicle protein 1
Rat(60353) acrosomal vesicle protein 1
cow(529863) acrosomal vesicle protein 1
domestic cat(101083618) acrosomal vesicle protein 1
dog(607249) acrosomal vesicle protein 1
domestic guinea pig(101788996) acrosomal vesicle protein 1
sheep(101111841) acrosomal vesicle protein 1
Domestic Rabbit(100008768) acrosomal vesicle protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001612 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001612 Rosetta Predictions human pricing
NM_020069 Rosetta Predictions human pricing
NM_020107 Rosetta Predictions human pricing
NM_020108 Rosetta Predictions human pricing
NM_020109 Rosetta Predictions human pricing
NM_020110 Rosetta Predictions human pricing
NM_020111 Rosetta Predictions human pricing
NM_020113 Rosetta Predictions human pricing
NM_020115 Rosetta Predictions human pricing
NM_021747 Rosetta Predictions rat pricing
NM_007391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010181 predicted 1021
2 SASI_Hs01_00010182 predicted 1038
3 SASI_Hs01_00010183 predicted 1066
4 SASI_Hs01_00010184 predicted 1022
5 SASI_Hs02_00332167 predicted 1041
6 SASI_Hs01_00010185 predicted 1019
7 SASI_Hs01_00010186 predicted 1028
8 SASI_Hs02_00332168 predicted 1042
9 SASI_Hs01_00010187 predicted 1024
10 SASI_Hs01_00010188 predicted 1040
11 SASI_Hs01_00010189 predicted 1071
12 SASI_Hs01_00010190 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147772 predicted 964
2 SASI_Hs01_00147773 predicted 975
3 SASI_Hs01_00147774 predicted 1005
4 SASI_Hs01_00147775 predicted 962
5 SASI_Hs02_00352955 predicted 984
6 SASI_Hs01_00147776 predicted 962
7 SASI_Hs01_00147777 predicted 974
8 SASI_Hs02_00352956 predicted 980
9 SASI_Hs01_00147778 predicted 970
10 SASI_Hs01_00147779 predicted 983
11 SASI_Hs01_00147780 predicted 1013
12 SASI_Hs01_00147781 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023161 predicted 856
2 SASI_Hs01_00023162 predicted 876
3 SASI_Hs01_00023163 predicted 901
4 SASI_Hs01_00023164 predicted 849
5 SASI_Hs02_00352957 predicted 873
6 SASI_Hs01_00023165 predicted 856
7 SASI_Hs01_00023166 predicted 866
8 SASI_Hs02_00352958 predicted 874
9 SASI_Hs01_00023167 predicted 865
10 SASI_Hs01_00023168 predicted 874
11 SASI_Hs01_00023169 predicted 899
12 SASI_Hs01_00023170 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242468 predicted 808
2 SASI_Hs01_00242469 predicted 824
3 SASI_Hs01_00242470 predicted 855
4 SASI_Hs01_00242471 predicted 805
5 SASI_Hs02_00352959 predicted 824
6 SASI_Hs01_00242472 predicted 807
7 SASI_Hs01_00242473 predicted 825
8 SASI_Hs02_00352960 predicted 827
9 SASI_Hs01_00242474 predicted 814
10 SASI_Hs01_00242475 predicted 827
11 SASI_Hs01_00242476 predicted 860
12 SASI_Hs01_00242477 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213928 predicted 746
2 SASI_Hs01_00213929 predicted 773
3 SASI_Hs01_00213930 predicted 798
4 SASI_Hs01_00213931 predicted 754
5 SASI_Hs02_00352961 predicted 770
6 SASI_Hs01_00213932 predicted 749
7 SASI_Hs01_00213933 predicted 761
8 SASI_Hs02_00352962 predicted 771
9 SASI_Hs01_00213934 predicted 758
10 SASI_Hs01_00213935 predicted 778
11 SASI_Hs01_00213936 predicted 800
12 SASI_Hs01_00213937 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245752 predicted 588
2 SASI_Hs01_00245753 predicted 602
3 SASI_Hs01_00245754 predicted 630
4 SASI_Hs01_00245755 predicted 588
5 SASI_Hs02_00352963 predicted 605
6 SASI_Hs01_00245756 predicted 588
7 SASI_Hs01_00245757 predicted 598
8 SASI_Hs02_00352964 predicted 604
9 SASI_Hs01_00245758 predicted 589
10 SASI_Hs01_00245759 predicted 606
11 SASI_Hs01_00245760 predicted 641
12 SASI_Hs01_00245761 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228732 predicted 737
2 SASI_Hs01_00228733 predicted 756
3 SASI_Hs01_00228734 predicted 777
4 SASI_Hs01_00228735 predicted 736
5 SASI_Hs02_00352965 predicted 749
6 SASI_Hs01_00228736 predicted 734
7 SASI_Hs01_00228737 predicted 750
8 SASI_Hs02_00352966 predicted 749
9 SASI_Hs01_00228738 predicted 736
10 SASI_Hs01_00228739 predicted 760
11 SASI_Hs01_00228740 predicted 781
12 SASI_Hs01_00228741 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119547 predicted 677
2 SASI_Hs01_00119548 predicted 706
3 SASI_Hs01_00119549 predicted 670
4 SASI_Hs01_00119550 predicted 572
5 SASI_Hs01_00119551 predicted 350
6 SASI_Hs01_00119553 predicted 668
7 SASI_Hs01_00119554 predicted 675
8 SASI_Hs01_00119555 predicted 572
9 SASI_Hs02_00352967 predicted 272
10 SASI_Hs02_00352968 predicted 544
11 SASI_Hs01_00119552 predicted 275
12 SASI_Hs01_00119556 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218019 predicted 452
2 SASI_Hs01_00218020 predicted 338
3 SASI_Hs02_00352969 predicted 266
4 SASI_Hs01_00218021 predicted 483
5 SASI_Hs01_00218022 predicted 451
6 SASI_Hs01_00218023 predicted 347
7 SASI_Hs01_00218026 predicted 446
8 SASI_Hs01_00218027 predicted 448
9 SASI_Hs01_00218028 predicted 325
10 SASI_Hs02_00352970 predicted 304
11 SASI_Hs01_00218024 predicted 413
12 SASI_Hs01_00218025 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050748 predicted 237
2 SASI_Rn01_00050749 predicted 453
3 SASI_Rn01_00050750 predicted 507
4 SASI_Rn01_00050751 predicted 434
5 SASI_Rn02_00262793 predicted 531
6 SASI_Rn01_00050752 predicted 531
7 SASI_Rn01_00050754 predicted 449
8 SASI_Rn02_00262794 predicted 204
9 SASI_Rn01_00050755 predicted 284
10 SASI_Rn02_00262795 predicted 528
11 SASI_Rn01_00050753 predicted 513
12 SASI_Rn01_00050756 predicted 478
13 SASI_Rn01_00050757 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098203 predicted 783
2 SASI_Mm01_00098205 predicted 620
3 SASI_Mm01_00098204 predicted 652
4 SASI_Mm01_00098206 predicted 834
5 SASI_Mm01_00098207 predicted 818
6 SASI_Mm01_00098208 predicted 764
7 SASI_Mm02_00311496 predicted 212
8 SASI_Mm01_00098211 predicted 554
9 SASI_Mm01_00098212 predicted 799
10 SASI_Mm02_00311497 predicted 873
11 SASI_Mm01_00098209 predicted 826
12 SASI_Mm01_00098210 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001612
ACRV1 MISSION shRNA Bacterial Glycerol Stock
acrosomal vesicle protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001612.4-1005s1c1
Sequence:CCGGCCATGGAACGAGGATGCAAATCTCGAGATTTGCATCCTCGTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001612.4-1110s1c1
Sequence:CCGGCCATCACTCTATTTGGCTCATCTCGAGATGAGCCAAATAGAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-1031s1c1
Sequence:CCGGGCTGTCGAAATCAATCTTTCTCTCGAGAGAAAGATTGATTTCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-451s1c1
Sequence:CCGGCTGAACACTTTAAGTGAGCATCTCGAGATGCTCACTTAAAGTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001612.4-809s1c1
Sequence:CCGGGCACATCTACAGGCACAATATCTCGAGATATTGTGCCTGTAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-909s1c1
Sequence:CCGGCCAGCAGTGCATGTTAAAGAACTCGAGTTCTTTAACATGCACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001612.4-347s1c1
Sequence:CCGGCTGGCTCCATAGATCATCAAACTCGAGTTTGATGATCTATGGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-571s1c1
Sequence:CCGGGAACATGCTGAAGGTGAGCATCTCGAGATGCTCACCTTCAGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001612.4-1150s1c1
Sequence:CCGGCCAGTCAACAACTGACCACATCTCGAGATGTGGTCAGTTGTTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-691s1c1
Sequence:CCGGGAACAGCCTTCAGGTGAACATCTCGAGATGTTCACCTGAAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001612
ACRV1 MISSION shRNA shRNA Plasmid DNA
acrosomal vesicle protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001612.4-1005s1c1
Sequence:CCGGCCATGGAACGAGGATGCAAATCTCGAGATTTGCATCCTCGTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001612.4-1110s1c1
Sequence:CCGGCCATCACTCTATTTGGCTCATCTCGAGATGAGCCAAATAGAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-1031s1c1
Sequence:CCGGGCTGTCGAAATCAATCTTTCTCTCGAGAGAAAGATTGATTTCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-451s1c1
Sequence:CCGGCTGAACACTTTAAGTGAGCATCTCGAGATGCTCACTTAAAGTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001612.4-809s1c1
Sequence:CCGGGCACATCTACAGGCACAATATCTCGAGATATTGTGCCTGTAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-909s1c1
Sequence:CCGGCCAGCAGTGCATGTTAAAGAACTCGAGTTCTTTAACATGCACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001612.4-347s1c1
Sequence:CCGGCTGGCTCCATAGATCATCAAACTCGAGTTTGATGATCTATGGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-571s1c1
Sequence:CCGGGAACATGCTGAAGGTGAGCATCTCGAGATGCTCACCTTCAGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001612.4-1150s1c1
Sequence:CCGGCCAGTCAACAACTGACCACATCTCGAGATGTGGTCAGTTGTTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-691s1c1
Sequence:CCGGGAACAGCCTTCAGGTGAACATCTCGAGATGTTCACCTGAAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001612
ACRV1 MISSION shRNA Lentiviral Transduction Particles
acrosomal vesicle protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001612.4-1005s1c1
Sequence:CCGGCCATGGAACGAGGATGCAAATCTCGAGATTTGCATCCTCGTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001612.4-1110s1c1
Sequence:CCGGCCATCACTCTATTTGGCTCATCTCGAGATGAGCCAAATAGAGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-1031s1c1
Sequence:CCGGGCTGTCGAAATCAATCTTTCTCTCGAGAGAAAGATTGATTTCGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-451s1c1
Sequence:CCGGCTGAACACTTTAAGTGAGCATCTCGAGATGCTCACTTAAAGTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001612.4-809s1c1
Sequence:CCGGGCACATCTACAGGCACAATATCTCGAGATATTGTGCCTGTAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-909s1c1
Sequence:CCGGCCAGCAGTGCATGTTAAAGAACTCGAGTTCTTTAACATGCACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001612.4-347s1c1
Sequence:CCGGCTGGCTCCATAGATCATCAAACTCGAGTTTGATGATCTATGGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-571s1c1
Sequence:CCGGGAACATGCTGAAGGTGAGCATCTCGAGATGCTCACCTTCAGCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001612.4-1150s1c1
Sequence:CCGGCCAGTCAACAACTGACCACATCTCGAGATGTGGTCAGTTGTTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001612.4-691s1c1
Sequence:CCGGGAACAGCCTTCAGGTGAACATCTCGAGATGTTCACCTGAAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007391
ACRV1 MISSION shRNA Bacterial Glycerol Stock
acrosomal vesicle protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007391.1-536s1c1
Sequence:CCGGCAGGTGTCTAGCGAGACAAATCTCGAGATTTGTCTCGCTAGACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007391.1-697s1c1
Sequence:CCGGGCAGTGCATGTTAAAGAAGATCTCGAGATCTTCTTTAACATGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007391.1-270s1c1
Sequence:CCGGGTTCAAGTGAACAGGAATCAACTCGAGTTGATTCCTGTTCACTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007391.1-861s1c1
Sequence:CCGGCCTACTTCTTGCTCTGACTTACTCGAGTAAGTCAGAGCAAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007391
ACRV1 MISSION shRNA shRNA Plasmid DNA
acrosomal vesicle protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007391.1-536s1c1
Sequence:CCGGCAGGTGTCTAGCGAGACAAATCTCGAGATTTGTCTCGCTAGACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007391.1-697s1c1
Sequence:CCGGGCAGTGCATGTTAAAGAAGATCTCGAGATCTTCTTTAACATGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007391.1-270s1c1
Sequence:CCGGGTTCAAGTGAACAGGAATCAACTCGAGTTGATTCCTGTTCACTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007391.1-861s1c1
Sequence:CCGGCCTACTTCTTGCTCTGACTTACTCGAGTAAGTCAGAGCAAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007391
ACRV1 MISSION shRNA Lentiviral Transduction Particles
acrosomal vesicle protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007391.1-536s1c1
Sequence:CCGGCAGGTGTCTAGCGAGACAAATCTCGAGATTTGTCTCGCTAGACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007391.1-697s1c1
Sequence:CCGGGCAGTGCATGTTAAAGAAGATCTCGAGATCTTCTTTAACATGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007391.1-270s1c1
Sequence:CCGGGTTCAAGTGAACAGGAATCAACTCGAGTTGATTCCTGTTCACTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007391.1-861s1c1
Sequence:CCGGCCTACTTCTTGCTCTGACTTACTCGAGTAAGTCAGAGCAAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks