EMAIL THIS PAGE TO A FRIEND

ACSBG1

acyl-CoA synthetase bubblegum family member 1

47 Gene Product Result for
Synonyms: BG BG1 BGM GR-LACS LPD
UniProtKB ID: Q96GR2, B2RB61, O75126, Q76N27, Q9HC26
Gene ID:
Human(23205) Summary: The protein encoded by this gene possesses long-chain acyl-CoA synthetase activity. It is thought to play a central role in brain very long-chain fatty acids metabolism and myelinogenesis. [provided by RefSeq, Jul 2008]
Mouse(94180) acyl-CoA synthetase bubblegum family member 1
Rat(171410) acyl-CoA synthetase bubblegum family member 1
chicken(415361) acyl-CoA synthetase bubblegum family member 1
domestic cat(101091449) acyl-CoA synthetase bubblegum family member 1
cow(515577) acyl-CoA synthetase bubblegum family member 1
dog(479067) acyl-CoA synthetase bubblegum family member 1
sheep(101121296) acyl-CoA synthetase bubblegum family member 1
naked mole-rat(101705669) acyl-CoA synthetase bubblegum family member 1
domestic guinea pig(100729604) acyl-CoA synthetase bubblegum family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015162 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015162 Rosetta Predictions human pricing
NM_134389 Rosetta Predictions rat pricing
NM_053178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137611 predicted 1927
2 SASI_Hs01_00137612 predicted 731
3 SASI_Hs02_00347141 predicted 1035
4 SASI_Hs01_00137613 predicted 1369
5 SASI_Hs01_00137614 predicted 649
6 SASI_Hs01_00137615 predicted 668
7 SASI_Hs01_00137616 predicted 2142
8 SASI_Hs01_00137617 predicted 2181
9 SASI_Hs01_00137618 predicted 1449
10 SASI_Hs01_00137619 predicted 1934
11 SASI_Hs01_00137620 predicted 2127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098678 predicted 694
2 SASI_Rn01_00098679 predicted 986
3 SASI_Rn01_00098680 predicted 734
4 SASI_Rn01_00098681 predicted 1708
5 SASI_Rn01_00098682 predicted 2144
6 SASI_Rn01_00098683 predicted 2109
7 SASI_Rn01_00098684 predicted 628
8 SASI_Rn02_00267954 predicted 1657
9 SASI_Rn01_00098685 predicted 1867
10 SASI_Rn01_00098686 predicted 1984
11 SASI_Rn01_00098687 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140229 predicted 881
2 SASI_Mm01_00140230 predicted 1169
3 SASI_Mm01_00140231 predicted 505
4 SASI_Mm01_00140232 predicted 1900
5 SASI_Mm01_00140233 predicted 2301
6 SASI_Mm01_00140234 predicted 348
7 SASI_Mm01_00140235 predicted 815
8 SASI_Mm01_00140236 predicted 2166
9 SASI_Mm01_00140237 predicted 339
10 SASI_Mm01_00140238 predicted 742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015162
ACSBG1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase bubblegum family member 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1508s1c1
Sequence:CCGGCATGTCCAGTCCCTACAACTACTCGAGTAGTTGTAGGGACTGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015162.3-883s1c1
Sequence:CCGGGCTGTGTGCTAGTCTACACTTCTCGAGAAGTGTAGACTAGCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-447s1c1
Sequence:CCGGGAACACATCTCCTACTCCCAACTCGAGTTGGGAGTAGGAGATGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2494s1c1
Sequence:CCGGCCAGAACGAAAGGGCTGATAACTCGAGTTATCAGCCCTTTCGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-643s1c1
Sequence:CCGGGCCAGTACATCGCTTATGACTCTCGAGAGTCATAAGCGATGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1628s1c1
Sequence:CCGGCATATTCATGGGCTACCTGAACTCGAGTTCAGGTAGCCCATGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1998s1c1
Sequence:CCGGGAGATCATAGAGAAGAAGGATCTCGAGATCCTTCTTCTCTATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1748s1c1
Sequence:CCGGGCGCCTCAAAGAATTAATCATCTCGAGATGATTAATTCTTTGAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2694s1c1
Sequence:CCGGGCCGACCCTATTATTCCATTACTCGAGTAATGGAATAATAGGGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2663s1c1
Sequence:CCGGCCTGACTTACTCTGGAATCTTCTCGAGAAGATTCCAGAGTAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2390s1c1
Sequence:CCGGCGCCAACAATAGCTGACAATTCTCGAGAATTGTCAGCTATTGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015162
ACSBG1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase bubblegum family member 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1508s1c1
Sequence:CCGGCATGTCCAGTCCCTACAACTACTCGAGTAGTTGTAGGGACTGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015162.3-883s1c1
Sequence:CCGGGCTGTGTGCTAGTCTACACTTCTCGAGAAGTGTAGACTAGCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-447s1c1
Sequence:CCGGGAACACATCTCCTACTCCCAACTCGAGTTGGGAGTAGGAGATGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2494s1c1
Sequence:CCGGCCAGAACGAAAGGGCTGATAACTCGAGTTATCAGCCCTTTCGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-643s1c1
Sequence:CCGGGCCAGTACATCGCTTATGACTCTCGAGAGTCATAAGCGATGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1628s1c1
Sequence:CCGGCATATTCATGGGCTACCTGAACTCGAGTTCAGGTAGCCCATGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1998s1c1
Sequence:CCGGGAGATCATAGAGAAGAAGGATCTCGAGATCCTTCTTCTCTATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1748s1c1
Sequence:CCGGGCGCCTCAAAGAATTAATCATCTCGAGATGATTAATTCTTTGAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2694s1c1
Sequence:CCGGGCCGACCCTATTATTCCATTACTCGAGTAATGGAATAATAGGGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2663s1c1
Sequence:CCGGCCTGACTTACTCTGGAATCTTCTCGAGAAGATTCCAGAGTAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2390s1c1
Sequence:CCGGCGCCAACAATAGCTGACAATTCTCGAGAATTGTCAGCTATTGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015162
ACSBG1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase bubblegum family member 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1508s1c1
Sequence:CCGGCATGTCCAGTCCCTACAACTACTCGAGTAGTTGTAGGGACTGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015162.3-883s1c1
Sequence:CCGGGCTGTGTGCTAGTCTACACTTCTCGAGAAGTGTAGACTAGCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-447s1c1
Sequence:CCGGGAACACATCTCCTACTCCCAACTCGAGTTGGGAGTAGGAGATGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2494s1c1
Sequence:CCGGCCAGAACGAAAGGGCTGATAACTCGAGTTATCAGCCCTTTCGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-643s1c1
Sequence:CCGGGCCAGTACATCGCTTATGACTCTCGAGAGTCATAAGCGATGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1628s1c1
Sequence:CCGGCATATTCATGGGCTACCTGAACTCGAGTTCAGGTAGCCCATGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1998s1c1
Sequence:CCGGGAGATCATAGAGAAGAAGGATCTCGAGATCCTTCTTCTCTATGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015162.3-1748s1c1
Sequence:CCGGGCGCCTCAAAGAATTAATCATCTCGAGATGATTAATTCTTTGAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2694s1c1
Sequence:CCGGGCCGACCCTATTATTCCATTACTCGAGTAATGGAATAATAGGGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2663s1c1
Sequence:CCGGCCTGACTTACTCTGGAATCTTCTCGAGAAGATTCCAGAGTAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015162.3-2390s1c1
Sequence:CCGGCGCCAACAATAGCTGACAATTCTCGAGAATTGTCAGCTATTGTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053178
ACSBG1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase bubblegum family member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053178.1-2578s1c1
Sequence:CCGGCCAGACCATTCTCCTTCCAAACTCGAGTTTGGAAGGAGAATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-1898s1c1
Sequence:CCGGGCGCCTCAAAGAATTAATCATCTCGAGATGATTAATTCTTTGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-1484s1c1
Sequence:CCGGACTGGCGGATTACCTAGTGTTCTCGAGAACACTAGGTAATCCGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-897s1c1
Sequence:CCGGGCAGTGGTGATATACCAAGAACTCGAGTTCTTGGTATATCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-599s1c1
Sequence:CCGGGCGTATCTCTTACTACCAGTACTCGAGTACTGGTAGTAAGAGATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053178
ACSBG1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase bubblegum family member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053178.1-2578s1c1
Sequence:CCGGCCAGACCATTCTCCTTCCAAACTCGAGTTTGGAAGGAGAATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-1898s1c1
Sequence:CCGGGCGCCTCAAAGAATTAATCATCTCGAGATGATTAATTCTTTGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-1484s1c1
Sequence:CCGGACTGGCGGATTACCTAGTGTTCTCGAGAACACTAGGTAATCCGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-897s1c1
Sequence:CCGGGCAGTGGTGATATACCAAGAACTCGAGTTCTTGGTATATCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-599s1c1
Sequence:CCGGGCGTATCTCTTACTACCAGTACTCGAGTACTGGTAGTAAGAGATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053178
ACSBG1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase bubblegum family member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053178.1-2578s1c1
Sequence:CCGGCCAGACCATTCTCCTTCCAAACTCGAGTTTGGAAGGAGAATGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-1898s1c1
Sequence:CCGGGCGCCTCAAAGAATTAATCATCTCGAGATGATTAATTCTTTGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-1484s1c1
Sequence:CCGGACTGGCGGATTACCTAGTGTTCTCGAGAACACTAGGTAATCCGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-897s1c1
Sequence:CCGGGCAGTGGTGATATACCAAGAACTCGAGTTCTTGGTATATCACCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053178.1-599s1c1
Sequence:CCGGGCGTATCTCTTACTACCAGTACTCGAGTACTGGTAGTAAGAGATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks