EMAIL THIS PAGE TO A FRIEND

ACSBG2

acyl-CoA synthetase bubblegum family member 2

50 Gene Product Result for
Synonyms: BGR BRGL PRTD-NY3 PRTDNY3
Gene ID:
Mouse(328845) acyl-CoA synthetase bubblegum family member 2
Rat(301120) acyl-CoA synthetase bubblegum family member 2
sheep(101110508) acyl-CoA synthetase bubblegum family member 2
Domestic Rabbit(100350310) acyl-CoA synthetase bubblegum family member 2
Zebrafish(335159) acyl-CoA synthetase bubblegum family member 2
cow(526688) acyl-CoA synthetase bubblegum family member 2
Horse(100065344) acyl-CoA synthetase bubblegum family member 2
domestic cat(101085442) acyl-CoA synthetase bubblegum family member 2
dog(476732) acyl-CoA synthetase bubblegum family member 2
chicken(420090) acyl-CoA synthetase bubblegum family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030924 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030924 Rosetta Predictions human pricing
NM_001080096 Rosetta Predictions rat pricing
NM_001039114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010363 predicted 1878
2 SASI_Hs02_00358477 predicted 1522
3 SASI_Hs01_00010364 predicted 664
4 SASI_Hs01_00010365 predicted 1900
5 SASI_Hs01_00010366 predicted 1054
6 SASI_Hs01_00010367 predicted 1771
7 SASI_Hs02_00358478 predicted 897
8 SASI_Hs01_00010369 predicted 1186
9 SASI_Hs01_00010370 predicted 1180
10 SASI_Hs01_00010371 predicted 2167
11 SASI_Hs01_00010368 predicted 1792
12 SASI_Hs01_00010372 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208389 predicted 419
2 SASI_Rn02_00208390 predicted 1300
3 SASI_Rn02_00208391 predicted 1602
4 SASI_Rn02_00208392 predicted 1107
5 SASI_Rn02_00208393 predicted 1305
6 SASI_Rn02_00208394 predicted 1899
7 SASI_Rn02_00208395 predicted 1955
8 SASI_Rn02_00208396 predicted 839
9 SASI_Rn02_00208397 predicted 2088
10 SASI_Rn02_00208398 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107536 predicted 896
2 SASI_Mm01_00107537 predicted 2098
3 SASI_Mm01_00107538 predicted 1223
4 SASI_Mm01_00107539 predicted 1322
5 SASI_Mm01_00107540 predicted 1339
6 SASI_Mm01_00107541 predicted 636
7 SASI_Mm02_00289804 predicted 1420
8 SASI_Mm01_00107542 predicted 378
9 SASI_Mm01_00107543 predicted 2337
10 SASI_Mm02_00289805 predicted 1731
11 SASI_Mm01_00107544 predicted 1806
12 SASI_Mm01_00107545 predicted 2172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030924
ACSBG2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase bubblegum family member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000164436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030924.2-411s1c1
Sequence:CCGGCGAGAGTCAGTCAACCGATTTCTCGAGAAATCGGTTGACTGACTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030924.2-1646s1c1
Sequence:CCGGGCACATCTTCATGGGCTATCTCTCGAGAGATAGCCCATGAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030924.2-2419s1c1
Sequence:CCGGCCATACGTTTCAAAGCAATAACTCGAGTTATTGCTTTGAAACGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030924.2-387s1c1
Sequence:CCGGCCGATGACCATCCCTGAATTTCTCGAGAAATTCAGGGATGGTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030924
ACSBG2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase bubblegum family member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000164436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030924.2-411s1c1
Sequence:CCGGCGAGAGTCAGTCAACCGATTTCTCGAGAAATCGGTTGACTGACTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030924.2-1646s1c1
Sequence:CCGGGCACATCTTCATGGGCTATCTCTCGAGAGATAGCCCATGAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030924.2-2419s1c1
Sequence:CCGGCCATACGTTTCAAAGCAATAACTCGAGTTATTGCTTTGAAACGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030924.2-387s1c1
Sequence:CCGGCCGATGACCATCCCTGAATTTCTCGAGAAATTCAGGGATGGTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030924
ACSBG2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase bubblegum family member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000164436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030924.2-411s1c1
Sequence:CCGGCGAGAGTCAGTCAACCGATTTCTCGAGAAATCGGTTGACTGACTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030924.2-1646s1c1
Sequence:CCGGGCACATCTTCATGGGCTATCTCTCGAGAGATAGCCCATGAAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030924.2-2419s1c1
Sequence:CCGGCCATACGTTTCAAAGCAATAACTCGAGTTATTGCTTTGAAACGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030924.2-387s1c1
Sequence:CCGGCCGATGACCATCCCTGAATTTCTCGAGAAATTCAGGGATGGTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039114
ACSBG2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase bubblegum family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039114.1-2437s21c1
Sequence:CCGGACAAGCCTTCCAGGCGTAAGTCTCGAGACTTACGCCTGGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-2123s21c1
Sequence:CCGGATGGCATAGACATCGTGAATCCTCGAGGATTCACGATGTCTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-1817s21c1
Sequence:CCGGATATCACTGGCCGCATCAAAGCTCGAGCTTTGATGCGGCCAGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-1051s21c1
Sequence:CCGGTCGCAAGAGATGGAGATAAACCTCGAGGTTTATCTCCATCTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-2063s21c1
Sequence:CCGGCAACCACTGTGTCGGACATTTCTCGAGAAATGTCCGACACAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039114
ACSBG2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase bubblegum family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039114.1-2437s21c1
Sequence:CCGGACAAGCCTTCCAGGCGTAAGTCTCGAGACTTACGCCTGGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-2123s21c1
Sequence:CCGGATGGCATAGACATCGTGAATCCTCGAGGATTCACGATGTCTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-1817s21c1
Sequence:CCGGATATCACTGGCCGCATCAAAGCTCGAGCTTTGATGCGGCCAGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-1051s21c1
Sequence:CCGGTCGCAAGAGATGGAGATAAACCTCGAGGTTTATCTCCATCTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-2063s21c1
Sequence:CCGGCAACCACTGTGTCGGACATTTCTCGAGAAATGTCCGACACAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039114
ACSBG2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase bubblegum family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039114.1-2437s21c1
Sequence:CCGGACAAGCCTTCCAGGCGTAAGTCTCGAGACTTACGCCTGGAAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-2123s21c1
Sequence:CCGGATGGCATAGACATCGTGAATCCTCGAGGATTCACGATGTCTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-1817s21c1
Sequence:CCGGATATCACTGGCCGCATCAAAGCTCGAGCTTTGATGCGGCCAGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-1051s21c1
Sequence:CCGGTCGCAAGAGATGGAGATAAACCTCGAGGTTTATCTCCATCTCTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039114.1-2063s21c1
Sequence:CCGGCAACCACTGTGTCGGACATTTCTCGAGAAATGTCCGACACAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks