EMAIL THIS PAGE TO A FRIEND

ACSF2

acyl-CoA synthetase family member 2

53 Gene Product Result for
Synonyms: ACSMW AVYV493
UniProtKB ID: Q96CM8, Q9H7G2
Gene ID:
Mouse(264895) acyl-CoA synthetase family member 2
Rat(619561) acyl-CoA synthetase family member 2
Zebrafish(751707) acyl-CoA synthetase family member 2
domestic cat(101090661) acyl-CoA synthetase family member 2
cow(768237) acyl-CoA synthetase family member 2
Horse(100069942) acyl-CoA synthetase family member 2
dog(480551) acyl-CoA synthetase family member 2
chicken(422102) acyl-CoA synthetase family member 2
sheep(101105582) acyl-CoA synthetase family member 2
naked mole-rat(101706188) acyl-CoA synthetase family member 2
domestic guinea pig(100714657) acyl-CoA synthetase family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025149 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025149 Rosetta Predictions human pricing
NM_001034951 Rosetta Predictions rat pricing
NM_153807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144207 predicted 1197
2 SASI_Hs02_00357882 predicted 1928
3 SASI_Hs01_00144209 predicted 1206
4 SASI_Hs01_00144210 predicted 1571
5 SASI_Hs02_00357883 predicted 1831
6 SASI_Hs01_00144211 predicted 1168
7 SASI_Hs01_00144212 predicted 1624
8 SASI_Hs01_00144213 predicted 728
9 SASI_Hs01_00144214 predicted 1054
10 SASI_Hs02_00357884 predicted 1923
11 SASI_Hs01_00144208 predicted 1308
12 SASI_Hs01_00144215 predicted 470
13 SASI_Hs01_00144216 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032491 predicted 475
2 SASI_Rn01_00032492 predicted 1233
3 SASI_Rn01_00032493 predicted 1226
4 SASI_Rn01_00032494 predicted 425
5 SASI_Rn01_00032495 predicted 1774
6 SASI_Rn01_00032496 predicted 1182
7 SASI_Rn01_00032497 predicted 384
8 SASI_Rn02_00204143 predicted 1199
9 SASI_Rn01_00032498 predicted 1921
10 SASI_Rn01_00032499 predicted 978
11 SASI_Rn01_00032500 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128198 predicted 1229
2 SASI_Mm02_00343544 predicted 1172
3 SASI_Mm02_00343545 predicted 520
4 SASI_Mm01_00128200 predicted 419
5 SASI_Mm01_00128202 predicted 312
6 SASI_Mm01_00128203 predicted 527
7 SASI_Mm01_00128204 predicted 1089
8 SASI_Mm01_00128205 predicted 410
9 SASI_Mm01_00128206 predicted 1460
10 SASI_Mm01_00128207 predicted 1489
11 SASI_Mm01_00128199 predicted 1744
12 SASI_Mm01_00128201 predicted 1183
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153807
VALIDATED
ACSF2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase family member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153807.2-417s21c1
Sequence:CCGGCCTATGCCTGGGTACTTATTCCTCGAGGAATAAGTACCCAGGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153807.2-2233s21c1
Sequence:CCGGGTCTTTGTGACTTGGTGTAAACTCGAGTTTACACCAAGTCACAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153807.2-1306s21c1
Sequence:CCGGTGGTAGTGTGGGCAGAATTATCTCGAGATAATTCTGCCCACACTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153807.1-2683s1c1
Sequence:CCGGGCCACAGATCAGTCCAGAAATCTCGAGATTTCTGGACTGATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-1085s1c1
Sequence:CCGGCCCACGATGTTTGTGGATATTCTCGAGAATATCCACAAACATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-1180s1c1
Sequence:CCGGCCCAGAATTGATTCGAGCCATCTCGAGATGGCTCGAATCAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-284s1c1
Sequence:CCGGGCTTTGGTTATCCTCCATGAACTCGAGTTCATGGAGGATAACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-692s1c1
Sequence:CCGGACCCTGCTCCTGGATGATATTCTCGAGAATATCATCCAGGAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153807
VALIDATED
ACSF2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase family member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153807.2-417s21c1
Sequence:CCGGCCTATGCCTGGGTACTTATTCCTCGAGGAATAAGTACCCAGGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153807.2-2233s21c1
Sequence:CCGGGTCTTTGTGACTTGGTGTAAACTCGAGTTTACACCAAGTCACAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153807.2-1306s21c1
Sequence:CCGGTGGTAGTGTGGGCAGAATTATCTCGAGATAATTCTGCCCACACTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153807.1-2683s1c1
Sequence:CCGGGCCACAGATCAGTCCAGAAATCTCGAGATTTCTGGACTGATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-1085s1c1
Sequence:CCGGCCCACGATGTTTGTGGATATTCTCGAGAATATCCACAAACATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-1180s1c1
Sequence:CCGGCCCAGAATTGATTCGAGCCATCTCGAGATGGCTCGAATCAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-284s1c1
Sequence:CCGGGCTTTGGTTATCCTCCATGAACTCGAGTTCATGGAGGATAACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-692s1c1
Sequence:CCGGACCCTGCTCCTGGATGATATTCTCGAGAATATCATCCAGGAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153807
VALIDATED
ACSF2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase family member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153807.2-417s21c1
Sequence:CCGGCCTATGCCTGGGTACTTATTCCTCGAGGAATAAGTACCCAGGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153807.2-2233s21c1
Sequence:CCGGGTCTTTGTGACTTGGTGTAAACTCGAGTTTACACCAAGTCACAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153807.2-1306s21c1
Sequence:CCGGTGGTAGTGTGGGCAGAATTATCTCGAGATAATTCTGCCCACACTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153807.1-2683s1c1
Sequence:CCGGGCCACAGATCAGTCCAGAAATCTCGAGATTTCTGGACTGATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-1085s1c1
Sequence:CCGGCCCACGATGTTTGTGGATATTCTCGAGAATATCCACAAACATCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-1180s1c1
Sequence:CCGGCCCAGAATTGATTCGAGCCATCTCGAGATGGCTCGAATCAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-284s1c1
Sequence:CCGGGCTTTGGTTATCCTCCATGAACTCGAGTTCATGGAGGATAACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_153807.1-692s1c1
Sequence:CCGGACCCTGCTCCTGGATGATATTCTCGAGAATATCATCCAGGAGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025149
VALIDATED
ACSF2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase family member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-1833s1c1
Sequence:CCGGCCAGAAATTCAAACTTCGAGACTCGAGTCTCGAAGTTTGAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-1681s1c1
Sequence:CCGGGAAGAGATTTGTGCCTGCATTCTCGAGAATGCAGGCACAAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-1608s1c1
Sequence:CCGGCGAGGACTTCTTTCACACACACTCGAGTGTGTGTGAAAGAAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-319s1c1
Sequence:CCGGGAAGACGTCAGGTTGACCTTTCTCGAGAAAGGTCAACCTGACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-585s1c1
Sequence:CCGGGCAATACTACAACGTCCTGAACTCGAGTTCAGGACGTTGTAGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-1554s1c1
Sequence:CCGGCCGCTCTAAGGATATGATCATCTCGAGATGATCATATCCTTAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-570s1c1
Sequence:CCGGGCAATTCAAGACCCAGCAATACTCGAGTATTGCTGGGTCTTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-1776s1c1
Sequence:CCGGGATTCCGAAGTACATCGTGTTCTCGAGAACACGATGTACTTCGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-234s1c1
Sequence:CCGGGCATCTTAACAGCAAGACTGTCTCGAGACAGTCTTGCTGTTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-870s1c1
Sequence:CCGGCATTGTCAACAACTCCAACATCTCGAGATGTTGGAGTTGTTGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025149
VALIDATED
ACSF2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase family member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-1833s1c1
Sequence:CCGGCCAGAAATTCAAACTTCGAGACTCGAGTCTCGAAGTTTGAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-1681s1c1
Sequence:CCGGGAAGAGATTTGTGCCTGCATTCTCGAGAATGCAGGCACAAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-1608s1c1
Sequence:CCGGCGAGGACTTCTTTCACACACACTCGAGTGTGTGTGAAAGAAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-319s1c1
Sequence:CCGGGAAGACGTCAGGTTGACCTTTCTCGAGAAAGGTCAACCTGACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-585s1c1
Sequence:CCGGGCAATACTACAACGTCCTGAACTCGAGTTCAGGACGTTGTAGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-1554s1c1
Sequence:CCGGCCGCTCTAAGGATATGATCATCTCGAGATGATCATATCCTTAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-570s1c1
Sequence:CCGGGCAATTCAAGACCCAGCAATACTCGAGTATTGCTGGGTCTTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-1776s1c1
Sequence:CCGGGATTCCGAAGTACATCGTGTTCTCGAGAACACGATGTACTTCGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-234s1c1
Sequence:CCGGGCATCTTAACAGCAAGACTGTCTCGAGACAGTCTTGCTGTTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-870s1c1
Sequence:CCGGCATTGTCAACAACTCCAACATCTCGAGATGTTGGAGTTGTTGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025149
VALIDATED
ACSF2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase family member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-1833s1c1
Sequence:CCGGCCAGAAATTCAAACTTCGAGACTCGAGTCTCGAAGTTTGAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-1681s1c1
Sequence:CCGGGAAGAGATTTGTGCCTGCATTCTCGAGAATGCAGGCACAAATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-1608s1c1
Sequence:CCGGCGAGGACTTCTTTCACACACACTCGAGTGTGTGTGAAAGAAGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-319s1c1
Sequence:CCGGGAAGACGTCAGGTTGACCTTTCTCGAGAAAGGTCAACCTGACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-585s1c1
Sequence:CCGGGCAATACTACAACGTCCTGAACTCGAGTTCAGGACGTTGTAGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-1554s1c1
Sequence:CCGGCCGCTCTAAGGATATGATCATCTCGAGATGATCATATCCTTAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-570s1c1
Sequence:CCGGGCAATTCAAGACCCAGCAATACTCGAGTATTGCTGGGTCTTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-1776s1c1
Sequence:CCGGGATTCCGAAGTACATCGTGTTCTCGAGAACACGATGTACTTCGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_025149.2-234s1c1
Sequence:CCGGGCATCTTAACAGCAAGACTGTCTCGAGACAGTCTTGCTGTTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_025149.2-870s1c1
Sequence:CCGGCATTGTCAACAACTCCAACATCTCGAGATGTTGGAGTTGTTGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks