EMAIL THIS PAGE TO A FRIEND

ACSF3

acyl-CoA synthetase family member 3

74 Gene Product Result for
UniProtKB ID: Q4G176, A8K4J8, C9JQL6, Q6INA0, Q8N2F7
Gene ID:
Human(197322) Summary: This gene encodes a member of the acyl-CoA synthetase family of enzymes that activate fatty acids by catalyzing the formation of a thioester linkage between fatty acids and coenzyme A. The encoded protein is localized to mitochondria, has high specificity for malonate and methylmalonate and possesses malonyl-CoA synthetase activity. Mutations in this gene are a cause of combined malonic and methylmalonic aciduria. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(257633) acyl-CoA synthetase family member 3
Rat(498962) acyl-CoA synthetase family member 3
domestic guinea pig(100729577) acyl-CoA synthetase family member 3
naked mole-rat(101708737) acyl-CoA synthetase family member 3
sheep(101109383) acyl-CoA synthetase family member 3
chicken(427561) acyl-CoA synthetase family member 3
cow(509209) acyl-CoA synthetase family member 3
Horse(100051639) acyl-CoA synthetase family member 3
dog(100683704) acyl-CoA synthetase family member 3
domestic cat(101099921) acyl-CoA synthetase family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174917 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127214 Rosetta Predictions human pricing
NM_174917 Rosetta Predictions human pricing
NR_023316 Rosetta Predictions human pricing
XM_001079424 Rosetta Predictions rat pricing
XM_574249 Rosetta Predictions rat pricing
NM_144932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328807 predicted 743
2 SASI_Hs02_00328808 predicted 462
3 SASI_Hs02_00328809 predicted 2009
4 SASI_Hs02_00328810 predicted 1671
5 SASI_Hs02_00328811 predicted 1768
6 SASI_Hs02_00328812 predicted 1455
7 SASI_Hs02_00328813 predicted 1066
8 SASI_Hs02_00328814 predicted 1317
9 SASI_Hs02_00328815 predicted 2026
10 SASI_Hs02_00328816 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135283 predicted 913
2 SASI_Hs01_00135284 predicted 630
3 SASI_Hs01_00135285 predicted 2176
4 SASI_Hs01_00135286 predicted 1844
5 SASI_Hs01_00135287 predicted 1935
6 SASI_Hs01_00135288 predicted 1625
7 SASI_Hs01_00135290 predicted 1235
8 SASI_Hs01_00135291 predicted 1488
9 SASI_Hs02_00368833 predicted 2192
10 SASI_Hs02_00368834 predicted 1712
11 SASI_Hs01_00135289 predicted 1060
12 SASI_Hs01_00135292 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381642 predicted 1313
2 SASI_Hs02_00381643 predicted 1070
3 SASI_Hs02_00381644 predicted 1150
4 SASI_Hs02_00381645 predicted 769
5 SASI_Hs02_00381646 predicted 485
6 SASI_Hs02_00381647 predicted 986
7 SASI_Hs02_00381648 predicted 378
8 SASI_Hs02_00381649 predicted 549
9 SASI_Hs02_00381650 predicted 381
10 SASI_Hs02_00381651 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364330 predicted 429
2 SASI_Rn02_00364331 predicted 1122
3 SASI_Rn02_00364332 predicted 778
4 SASI_Rn02_00364333 predicted 538
5 SASI_Rn02_00364334 predicted 1648
6 SASI_Rn02_00364335 predicted 1724
7 SASI_Rn02_00364336 predicted 1729
8 SASI_Rn02_00364337 predicted 313
9 SASI_Rn02_00364338 predicted 261
10 SASI_Rn02_00364339 predicted 1718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401654 predicted 540
2 SASI_Rn02_00401655 predicted 1231
3 SASI_Rn02_00401656 predicted 886
4 SASI_Rn02_00401657 predicted 650
5 SASI_Rn02_00401658 predicted 1761
6 SASI_Rn02_00401659 predicted 1833
7 SASI_Rn02_00401660 predicted 1846
8 SASI_Rn02_00401661 predicted 421
9 SASI_Rn02_00401662 predicted 370
10 SASI_Rn02_00401663 predicted 1827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340446 predicted 624
2 SASI_Mm02_00340447 predicted 295
3 SASI_Mm02_00340448 predicted 297
4 SASI_Mm02_00340449 predicted 1530
5 SASI_Mm02_00340450 predicted 785
6 SASI_Mm02_00340451 predicted 893
7 SASI_Mm02_00340452 predicted 1255
8 SASI_Mm02_00340453 predicted 316
9 SASI_Mm02_00340454 predicted 895
10 SASI_Mm02_00340455 predicted 784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144932
VALIDATED
ACSF3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase family member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144932.2-1402s1c1
Sequence:CCGGCCAGTCTCACAAGCACAGTAACTCGAGTTACTGTGCTTGTGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144932.2-740s1c1
Sequence:CCGGGTTCCGAGAATACTGGGATAACTCGAGTTATCCCAGTATTCTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144932.2-996s1c1
Sequence:CCGGGCTGTGGTTGCTCTTCAAGAACTCGAGTTCTTGAAGAGCAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144932.3-179s21c1
Sequence:CCGGCAGAAGACACCGAGGACATAGCTCGAGCTATGTCCTCGGTGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144932.3-1533s21c1
Sequence:CCGGATCAAGACTGGAGGCTATAAACTCGAGTTTATAGCCTCCAGTCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144932
VALIDATED
ACSF3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase family member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144932.2-1402s1c1
Sequence:CCGGCCAGTCTCACAAGCACAGTAACTCGAGTTACTGTGCTTGTGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144932.2-740s1c1
Sequence:CCGGGTTCCGAGAATACTGGGATAACTCGAGTTATCCCAGTATTCTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144932.2-996s1c1
Sequence:CCGGGCTGTGGTTGCTCTTCAAGAACTCGAGTTCTTGAAGAGCAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144932.3-179s21c1
Sequence:CCGGCAGAAGACACCGAGGACATAGCTCGAGCTATGTCCTCGGTGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144932.3-1533s21c1
Sequence:CCGGATCAAGACTGGAGGCTATAAACTCGAGTTTATAGCCTCCAGTCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144932
VALIDATED
ACSF3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase family member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144932.2-1402s1c1
Sequence:CCGGCCAGTCTCACAAGCACAGTAACTCGAGTTACTGTGCTTGTGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144932.2-740s1c1
Sequence:CCGGGTTCCGAGAATACTGGGATAACTCGAGTTATCCCAGTATTCTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_144932.2-996s1c1
Sequence:CCGGGCTGTGGTTGCTCTTCAAGAACTCGAGTTCTTGAAGAGCAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144932.3-179s21c1
Sequence:CCGGCAGAAGACACCGAGGACATAGCTCGAGCTATGTCCTCGGTGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144932.3-1533s21c1
Sequence:CCGGATCAAGACTGGAGGCTATAAACTCGAGTTTATAGCCTCCAGTCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174917
ACSF3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase family member 3
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1695s1c1
Sequence:CCGGCATCATCAAGACTGGAGGCTACTCGAGTAGCCTCCAGTCTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174917.1-1210s1c1
Sequence:CCGGCAGGATTTCTTGCGTGCAGTTCTCGAGAACTGCACGCAAGAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1950s1c1
Sequence:CCGGGATGGGCAAGATTGACAAGAACTCGAGTTCTTGTCAATCTTGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-2960s1c1
Sequence:CCGGCCAGAAGTTTCTGGACAATTTCTCGAGAAATTGTCCAGAAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1126s1c1
Sequence:CCGGCGGATCAATGTCTTTATGGCACTCGAGTGCCATAAAGACATTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-3049s1c1
Sequence:CCGGCCTGAACTTACCCAGAACATTCTCGAGAATGTTCTGGGTAAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1698s1c1
Sequence:CCGGCATCAAGACTGGAGGCTACAACTCGAGTTGTAGCCTCCAGTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1771s1c1
Sequence:CCGGGATGTGGCTGTGATTGGAGTTCTCGAGAACTCCAATCACAGCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-3048s1c1
Sequence:CCGGGCCTGAACTTACCCAGAACATCTCGAGATGTTCTGGGTAAGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1287s1c1
Sequence:CCGGGCTGGAGAAGTGGAAGAACATCTCGAGATGTTCTTCCACTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1690s1c1
Sequence:CCGGGTGGACATCATCAAGACTGGACTCGAGTCCAGTCTTGATGATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-2899s1c1
Sequence:CCGGGCACCCACGTTGCATTTACTTCTCGAGAAGTAAATGCAACGTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-1209s21c1
Sequence:GTACCGGTTATGGCAGTGCCTACAATATCTCGAGATATTGTAGGCACTGCCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174917.2-2180s21c1
Sequence:CCGGCAAATCAGGTCACGTAGAATCCTCGAGGATTCTACGTGACCTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-1937s21c1
Sequence:CCGGCTCAAAGAGTGGGCCAGAAATCTCGAGATTTCTGGCCCACTCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-1627s21c1
Sequence:CCGGACCCTCCGTGTTTCGAGAATACTCGAGTATTCTCGAAACACGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-537s21c1
Sequence:CCGGACACGTACAGGGAGCTTTATTCTCGAGAATAAAGCTCCCTGTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174917
ACSF3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase family member 3
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1695s1c1
Sequence:CCGGCATCATCAAGACTGGAGGCTACTCGAGTAGCCTCCAGTCTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174917.1-1210s1c1
Sequence:CCGGCAGGATTTCTTGCGTGCAGTTCTCGAGAACTGCACGCAAGAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1950s1c1
Sequence:CCGGGATGGGCAAGATTGACAAGAACTCGAGTTCTTGTCAATCTTGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-2960s1c1
Sequence:CCGGCCAGAAGTTTCTGGACAATTTCTCGAGAAATTGTCCAGAAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1126s1c1
Sequence:CCGGCGGATCAATGTCTTTATGGCACTCGAGTGCCATAAAGACATTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-3049s1c1
Sequence:CCGGCCTGAACTTACCCAGAACATTCTCGAGAATGTTCTGGGTAAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1698s1c1
Sequence:CCGGCATCAAGACTGGAGGCTACAACTCGAGTTGTAGCCTCCAGTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1771s1c1
Sequence:CCGGGATGTGGCTGTGATTGGAGTTCTCGAGAACTCCAATCACAGCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-3048s1c1
Sequence:CCGGGCCTGAACTTACCCAGAACATCTCGAGATGTTCTGGGTAAGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1287s1c1
Sequence:CCGGGCTGGAGAAGTGGAAGAACATCTCGAGATGTTCTTCCACTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1690s1c1
Sequence:CCGGGTGGACATCATCAAGACTGGACTCGAGTCCAGTCTTGATGATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-2899s1c1
Sequence:CCGGGCACCCACGTTGCATTTACTTCTCGAGAAGTAAATGCAACGTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-1209s21c1
Sequence:GTACCGGTTATGGCAGTGCCTACAATATCTCGAGATATTGTAGGCACTGCCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174917.2-2180s21c1
Sequence:CCGGCAAATCAGGTCACGTAGAATCCTCGAGGATTCTACGTGACCTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-1937s21c1
Sequence:CCGGCTCAAAGAGTGGGCCAGAAATCTCGAGATTTCTGGCCCACTCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-1627s21c1
Sequence:CCGGACCCTCCGTGTTTCGAGAATACTCGAGTATTCTCGAAACACGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-537s21c1
Sequence:CCGGACACGTACAGGGAGCTTTATTCTCGAGAATAAAGCTCCCTGTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174917
ACSF3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase family member 3
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156424    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1695s1c1
Sequence:CCGGCATCATCAAGACTGGAGGCTACTCGAGTAGCCTCCAGTCTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174917.1-1210s1c1
Sequence:CCGGCAGGATTTCTTGCGTGCAGTTCTCGAGAACTGCACGCAAGAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1950s1c1
Sequence:CCGGGATGGGCAAGATTGACAAGAACTCGAGTTCTTGTCAATCTTGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-2960s1c1
Sequence:CCGGCCAGAAGTTTCTGGACAATTTCTCGAGAAATTGTCCAGAAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1126s1c1
Sequence:CCGGCGGATCAATGTCTTTATGGCACTCGAGTGCCATAAAGACATTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155629    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-3049s1c1
Sequence:CCGGCCTGAACTTACCCAGAACATTCTCGAGAATGTTCTGGGTAAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1698s1c1
Sequence:CCGGCATCAAGACTGGAGGCTACAACTCGAGTTGTAGCCTCCAGTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1771s1c1
Sequence:CCGGGATGTGGCTGTGATTGGAGTTCTCGAGAACTCCAATCACAGCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156922    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-3048s1c1
Sequence:CCGGGCCTGAACTTACCCAGAACATCTCGAGATGTTCTGGGTAAGTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1287s1c1
Sequence:CCGGGCTGGAGAAGTGGAAGAACATCTCGAGATGTTCTTCCACTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174917.1-1690s1c1
Sequence:CCGGGTGGACATCATCAAGACTGGACTCGAGTCCAGTCTTGATGATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174917.1-2899s1c1
Sequence:CCGGGCACCCACGTTGCATTTACTTCTCGAGAAGTAAATGCAACGTGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-1209s21c1
Sequence:GTACCGGTTATGGCAGTGCCTACAATATCTCGAGATATTGTAGGCACTGCCATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231122    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174917.2-2180s21c1
Sequence:CCGGCAAATCAGGTCACGTAGAATCCTCGAGGATTCTACGTGACCTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-1937s21c1
Sequence:CCGGCTCAAAGAGTGGGCCAGAAATCTCGAGATTTCTGGCCCACTCTTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-1627s21c1
Sequence:CCGGACCCTCCGTGTTTCGAGAATACTCGAGTATTCTCGAAACACGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174917.2-537s21c1
Sequence:CCGGACACGTACAGGGAGCTTTATTCTCGAGAATAAAGCTCCCTGTACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks