EMAIL THIS PAGE TO A FRIEND

ACSL1

acyl-CoA synthetase long-chain family member 1

154 Gene Product Result for
Synonyms: ACS1 FACL1 FACL2 LACS LACS1 LACS2
UniProtKB ID: P33121, D3DP57, P41215, Q8N8V7, Q8TA99
Gene ID:
Human(2180) Summary: The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. [provided by RefSeq, Jul 2008]
Mouse(14081) acyl-CoA synthetase long-chain family member 1
Rat(25288) acyl-CoA synthetase long-chain family member 1
Zebrafish(555308) acyl-CoA synthetase long-chain family member 1
cow(518552) acyl-CoA synthetase long-chain family member 1
cow(537161) acyl-CoA synthetase long-chain family member 1
Horse(100057925) acyl-CoA synthetase long-chain family member 1
domestic cat(101090257) acyl-CoA synthetase long-chain family member 1
dog(475631) acyl-CoA synthetase long-chain family member 1
chicken(422547) acyl-CoA synthetase long-chain family member 1
sheep(101110905) acyl-CoA synthetase long-chain family member 1
naked mole-rat(101704574) acyl-CoA synthetase long-chain family member 1
domestic guinea pig(100135469) acyl-CoA synthetase long-chain family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001995 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001995 Rosetta Predictions human pricing
NM_012820 Rosetta Predictions rat pricing
NM_007981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202187 predicted 2268
2 SASI_Hs01_00202188 predicted 660
3 SASI_Hs01_00202189 predicted 1711
4 SASI_Hs01_00202190 predicted 713
5 SASI_Hs01_00202191 predicted 2225
6 SASI_Hs01_00202192 predicted 798
7 SASI_Hs01_00202193 predicted 227
8 SASI_Hs01_00202194 predicted 1938
9 SASI_Hs01_00202195 predicted 1697
10 SASI_Hs01_00202196 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073026 predicted 2059
2 SASI_Rn01_00073027 predicted 733
3 SASI_Rn01_00073028 predicted 1642
4 SASI_Rn01_00073029 predicted 814
5 SASI_Rn01_00073031 predicted 2094
6 SASI_Rn01_00073032 predicted 2151
7 SASI_Rn01_00073033 predicted 363
8 SASI_Rn02_00260271 predicted 2085
9 SASI_Rn02_00260272 predicted 999
10 SASI_Rn01_00073034 predicted 633
11 SASI_Rn01_00073030 predicted 2219
12 SASI_Rn01_00073035 predicted 1251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166831 predicted 2262
2 SASI_Mm01_00166832 predicted 1812
3 SASI_Mm01_00166833 predicted 1024
4 SASI_Mm01_00166834 predicted 2307
5 SASI_Mm01_00166835 predicted 859
6 SASI_Mm01_00166836 predicted 534
7 SASI_Mm01_00166837 predicted 522
8 SASI_Mm01_00166838 predicted 2353
9 SASI_Mm01_00166839 predicted 421
10 SASI_Mm01_00166840 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001995
VALIDATED
ACSL1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase long-chain family member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-647s21c1
Sequence:CCGGAGACCTGAGTGGGTGATTATTCTCGAGAATAATCACCCACTCAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001995.2-2549s21c1
Sequence:CCGGTTGAGACTTCCTCAGTTTAAACTCGAGTTTAAACTGAGGAAGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-2146s21c1
Sequence:CCGGCACATTGCACCCTGAATTATTCTCGAGAATAATTCAGGGTGCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-1290s21c1
Sequence:CCGGACCGGATGTTTGACCGAATTTCTCGAGAAATTCGGTCAAACATCCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-691s21c1
Sequence:CCGGGATGGTGATCGTTCCACTTTACTCGAGTAAAGTGGAACGATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001995.2-419s1c1
Sequence:CCGGCCCTTGGTGTATTTCTATGATCTCGAGATCATAGAAATACACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_001995.2-613s1c1
Sequence:CCGGCCCAGATCAGTTCATTGGCATCTCGAGATGCCAATGAACTGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001995.2-1714s1c1
Sequence:CCGGGCCAAATGTATTTCAGGGCTACTCGAGTAGCCCTGAAATACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001995.2-1110s1c1
Sequence:CCGGGCCCAGATGATACTTTGATATCTCGAGATATCAAAGTATCATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001995.2-2238s1c1
Sequence:CCGGCGCAGATAGATGACCTCTATTCTCGAGAATAGAGGTCATCTATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001995
VALIDATED
ACSL1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase long-chain family member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-647s21c1
Sequence:CCGGAGACCTGAGTGGGTGATTATTCTCGAGAATAATCACCCACTCAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001995.2-2549s21c1
Sequence:CCGGTTGAGACTTCCTCAGTTTAAACTCGAGTTTAAACTGAGGAAGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-2146s21c1
Sequence:CCGGCACATTGCACCCTGAATTATTCTCGAGAATAATTCAGGGTGCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-1290s21c1
Sequence:CCGGACCGGATGTTTGACCGAATTTCTCGAGAAATTCGGTCAAACATCCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-691s21c1
Sequence:CCGGGATGGTGATCGTTCCACTTTACTCGAGTAAAGTGGAACGATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001995.2-419s1c1
Sequence:CCGGCCCTTGGTGTATTTCTATGATCTCGAGATCATAGAAATACACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_001995.2-613s1c1
Sequence:CCGGCCCAGATCAGTTCATTGGCATCTCGAGATGCCAATGAACTGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001995.2-1714s1c1
Sequence:CCGGGCCAAATGTATTTCAGGGCTACTCGAGTAGCCCTGAAATACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001995.2-1110s1c1
Sequence:CCGGGCCCAGATGATACTTTGATATCTCGAGATATCAAAGTATCATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001995.2-2238s1c1
Sequence:CCGGCGCAGATAGATGACCTCTATTCTCGAGAATAGAGGTCATCTATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001995
VALIDATED
ACSL1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase long-chain family member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-647s21c1
Sequence:CCGGAGACCTGAGTGGGTGATTATTCTCGAGAATAATCACCCACTCAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001995.2-2549s21c1
Sequence:CCGGTTGAGACTTCCTCAGTTTAAACTCGAGTTTAAACTGAGGAAGTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-2146s21c1
Sequence:CCGGCACATTGCACCCTGAATTATTCTCGAGAATAATTCAGGGTGCAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-1290s21c1
Sequence:CCGGACCGGATGTTTGACCGAATTTCTCGAGAAATTCGGTCAAACATCCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001995.2-691s21c1
Sequence:CCGGGATGGTGATCGTTCCACTTTACTCGAGTAAAGTGGAACGATCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001995.2-419s1c1
Sequence:CCGGCCCTTGGTGTATTTCTATGATCTCGAGATCATAGAAATACACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_001995.2-613s1c1
Sequence:CCGGCCCAGATCAGTTCATTGGCATCTCGAGATGCCAATGAACTGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001995.2-1714s1c1
Sequence:CCGGGCCAAATGTATTTCAGGGCTACTCGAGTAGCCCTGAAATACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001995.2-1110s1c1
Sequence:CCGGGCCCAGATGATACTTTGATATCTCGAGATATCAAAGTATCATCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_001995.2-2238s1c1
Sequence:CCGGCGCAGATAGATGACCTCTATTCTCGAGAATAGAGGTCATCTATCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007981
VALIDATED
ACSL1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase long-chain family member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-2132s21c1
Sequence:CCGGCGACTTGTTGAAACTTGGGAACTCGAGTTCCCAAGTTTCAACAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-1454s21c1
Sequence:CCGGCCTGTGGGATAAACTCATCTTCTCGAGAAGATGAGTTTATCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-263s21c1
Sequence:CCGGGCTGATTGACATTCGGCAGTACTCGAGTACTGCCGAATGTCAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-1024s21c1
Sequence:CCGGCCGAAGATCTTGCGATAATTTCTCGAGAAATTATCGCAAGATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-1315s1c2
Sequence:CCGGCCTGTGGGATAAACTCATCTTCTCGAGAAGATGAGTTTATCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-2617s1c1
Sequence:CCGGCCCTTTAAGAACAACTGTCCACTCGAGTGGACAGTTGTTCTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-885s1c1
Sequence:CCGGCCGAAGATCTTGCGATAATTTCTCGAGAAATTATCGCAAGATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-124s1c1
Sequence:CCGGGCTGATTGACATTCGGCAGTACTCGAGTACTGCCGAATGTCAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-1993s1c1
Sequence:CCGGCGACTTGTTGAAACTTGGGAACTCGAGTTCCCAAGTTTCAACAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007981
VALIDATED
ACSL1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase long-chain family member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-2132s21c1
Sequence:CCGGCGACTTGTTGAAACTTGGGAACTCGAGTTCCCAAGTTTCAACAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-1454s21c1
Sequence:CCGGCCTGTGGGATAAACTCATCTTCTCGAGAAGATGAGTTTATCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-263s21c1
Sequence:CCGGGCTGATTGACATTCGGCAGTACTCGAGTACTGCCGAATGTCAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-1024s21c1
Sequence:CCGGCCGAAGATCTTGCGATAATTTCTCGAGAAATTATCGCAAGATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-1315s1c2
Sequence:CCGGCCTGTGGGATAAACTCATCTTCTCGAGAAGATGAGTTTATCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-2617s1c1
Sequence:CCGGCCCTTTAAGAACAACTGTCCACTCGAGTGGACAGTTGTTCTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-885s1c1
Sequence:CCGGCCGAAGATCTTGCGATAATTTCTCGAGAAATTATCGCAAGATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-124s1c1
Sequence:CCGGGCTGATTGACATTCGGCAGTACTCGAGTACTGCCGAATGTCAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-1993s1c1
Sequence:CCGGCGACTTGTTGAAACTTGGGAACTCGAGTTCCCAAGTTTCAACAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007981
VALIDATED
ACSL1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase long-chain family member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-2132s21c1
Sequence:CCGGCGACTTGTTGAAACTTGGGAACTCGAGTTCCCAAGTTTCAACAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-1454s21c1
Sequence:CCGGCCTGTGGGATAAACTCATCTTCTCGAGAAGATGAGTTTATCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-263s21c1
Sequence:CCGGGCTGATTGACATTCGGCAGTACTCGAGTACTGCCGAATGTCAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007981.3-1024s21c1
Sequence:CCGGCCGAAGATCTTGCGATAATTTCTCGAGAAATTATCGCAAGATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-1315s1c2
Sequence:CCGGCCTGTGGGATAAACTCATCTTCTCGAGAAGATGAGTTTATCCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-2617s1c1
Sequence:CCGGCCCTTTAAGAACAACTGTCCACTCGAGTGGACAGTTGTTCTTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-885s1c1
Sequence:CCGGCCGAAGATCTTGCGATAATTTCTCGAGAAATTATCGCAAGATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-124s1c1
Sequence:CCGGGCTGATTGACATTCGGCAGTACTCGAGTACTGCCGAATGTCAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007981.2-1993s1c1
Sequence:CCGGCGACTTGTTGAAACTTGGGAACTCGAGTTCCCAAGTTTCAACAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks