EMAIL THIS PAGE TO A FRIEND

ACSL3

acyl-CoA synthetase long-chain family member 3

122 Gene Product Result for
Synonyms: ACS3 FACL3 PRO2194
UniProtKB ID: O95573, Q60I92, Q8IUM9
Gene ID:
Human(2181) Summary: The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(74205) acyl-CoA synthetase long-chain family member 3
Rat(114024) acyl-CoA synthetase long-chain family member 3
domestic guinea pig(100730703) acyl-CoA synthetase long-chain family member 3
naked mole-rat(101701097) acyl-CoA synthetase long-chain family member 3
sheep(101120728) acyl-CoA synthetase long-chain family member 3
Domestic Rabbit(100358351) acyl-CoA synthetase long-chain family member 3
chicken(424810) acyl-CoA synthetase long-chain family member 3
dog(478927) acyl-CoA synthetase long-chain family member 3
domestic cat(101081999) acyl-CoA synthetase long-chain family member 3
cow(100138312) acyl-CoA synthetase long-chain family member 3
Horse(100056656) acyl-CoA synthetase long-chain family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_129894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004457 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087281 MISSION® esiRNA esiRNA human ACSL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004457 Rosetta Predictions human pricing
NM_203372 Rosetta Predictions human pricing
NM_057107 Rosetta Predictions rat pricing
NM_001033606 Rosetta Predictions mouse pricing
NM_028817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034737 predicted 840
2 SASI_Hs01_00034738 predicted 1090
3 SASI_Hs02_00337645 predicted 790
4 SASI_Hs01_00034739 predicted 1198
5 SASI_Hs01_00034740 predicted 1717
6 SASI_Hs01_00034741 predicted 2338
7 SASI_Hs01_00034742 predicted 1505
8 SASI_Hs01_00034743 predicted 1338
9 SASI_Hs02_00337646 predicted 1066
10 SASI_Hs02_00337647 predicted 1355
11 SASI_Hs01_00034734 predicted 1834
12 SASI_Hs01_00034735 predicted 2310
13 SASI_Hs01_00034736 predicted 2115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055185 predicted 727
2 SASI_Hs01_00055186 predicted 988
3 SASI_Hs02_00373300 predicted 688
4 SASI_Hs01_00055187 predicted 1085
5 SASI_Hs01_00055188 predicted 1605
6 SASI_Hs01_00055189 predicted 2234
7 SASI_Hs01_00055190 predicted 1405
8 SASI_Hs01_00055191 predicted 1237
9 SASI_Hs02_00373301 predicted 963
10 SASI_Hs02_00373302 predicted 1246
11 SASI_Hs01_00055182 predicted 1730
12 SASI_Hs01_00055183 predicted 2212
13 SASI_Hs01_00055184 predicted 2007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100113 predicted 602
2 SASI_Rn01_00100114 predicted 435
3 SASI_Rn01_00100115 predicted 666
4 SASI_Rn02_00267040 predicted 1104
5 SASI_Rn01_00100116 predicted 1764
6 SASI_Rn01_00100117 predicted 950
7 SASI_Rn01_00100118 predicted 2283
8 SASI_Rn01_00100119 predicted 830
9 SASI_Rn01_00100120 predicted 630
10 SASI_Rn01_00100121 predicted 2162
11 SASI_Rn01_00100122 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075015 predicted 1899
2 SASI_Mm01_00075017 predicted 2503
3 SASI_Mm02_00288933 predicted 2359
4 SASI_Mm01_00075018 predicted 1660
5 SASI_Mm01_00075020 predicted 1966
6 SASI_Mm01_00075022 predicted 2063
7 SASI_Mm01_00075023 predicted 2113
8 SASI_Mm01_00075024 predicted 2185
9 SASI_Mm02_00288934 predicted 2234
10 SASI_Mm02_00288935 predicted 1759
11 SASI_Mm01_00075016 predicted 297
12 SASI_Mm01_00075019 predicted 864
13 SASI_Mm01_00075021 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090826 predicted 2039
2 SASI_Mm01_00090827 predicted 2643
3 SASI_Mm01_00090828 predicted 2503
4 SASI_Mm01_00090829 predicted 1795
5 SASI_Mm01_00090830 predicted 2107
6 SASI_Mm01_00090831 predicted 2200
7 SASI_Mm01_00090832 predicted 2258
8 SASI_Mm01_00090833 predicted 2326
9 SASI_Mm01_00090834 predicted 2381
10 SASI_Mm02_00334434 predicted 1906
11 SASI_Mm01_00090835 predicted 2353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129894
VALIDATED
ACSL3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase long-chain family member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129894.4-2641s1c1
Sequence:CCGGGCAAACTCCATTCCTCATATTCTCGAGAATATGAGGAATGGAGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129894.4-1092s1c1
Sequence:CCGGCTGCGGCATATCATTACTGTTCTCGAGAACAGTAATGATATGCCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129894.4-2490s1c1
Sequence:CCGGGCCTTCAAGTTGAAACGTAAACTCGAGTTTACGTTTCAACTTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129894.4-1897s1c1
Sequence:CCGGCACCATTAGTTTGCTGTGAAACTCGAGTTTCACAGCAAACTAATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129894.4-2236s1c1
Sequence:CCGGCGTATGCAAACAGCTACCATTCTCGAGAATGGTAGCTGTTTGCATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129894
VALIDATED
ACSL3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase long-chain family member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129894.4-2641s1c1
Sequence:CCGGGCAAACTCCATTCCTCATATTCTCGAGAATATGAGGAATGGAGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129894.4-1092s1c1
Sequence:CCGGCTGCGGCATATCATTACTGTTCTCGAGAACAGTAATGATATGCCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129894.4-2490s1c1
Sequence:CCGGGCCTTCAAGTTGAAACGTAAACTCGAGTTTACGTTTCAACTTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129894.4-1897s1c1
Sequence:CCGGCACCATTAGTTTGCTGTGAAACTCGAGTTTCACAGCAAACTAATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129894.4-2236s1c1
Sequence:CCGGCGTATGCAAACAGCTACCATTCTCGAGAATGGTAGCTGTTTGCATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129894
VALIDATED
ACSL3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase long-chain family member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129894.4-2641s1c1
Sequence:CCGGGCAAACTCCATTCCTCATATTCTCGAGAATATGAGGAATGGAGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129894.4-1092s1c1
Sequence:CCGGCTGCGGCATATCATTACTGTTCTCGAGAACAGTAATGATATGCCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129894.4-2490s1c1
Sequence:CCGGGCCTTCAAGTTGAAACGTAAACTCGAGTTTACGTTTCAACTTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129894.4-1897s1c1
Sequence:CCGGCACCATTAGTTTGCTGTGAAACTCGAGTTTCACAGCAAACTAATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_129894.4-2236s1c1
Sequence:CCGGCGTATGCAAACAGCTACCATTCTCGAGAATGGTAGCTGTTTGCATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004457
VALIDATED
ACSL3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase long-chain family member 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-1282s1c1
Sequence:CCGGGCCCTCAGATATTGCAGTAATCTCGAGATTACTGCAATATCTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-2582s1c1
Sequence:CCGGGCGGACATTGAGCGAATGTATCTCGAGATACATTCGCTCAATGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-2392s1c1
Sequence:CCGGGCTGTGTAACAGTTGTGAAATCTCGAGATTTCACAACTGTTACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-698s1c1
Sequence:CCGGCCTGGATGTGATACTTTAGATCTCGAGATCTAAAGTATCACATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-2540s1c1
Sequence:CCGGGCCTTCAAGCTGAAACGCAAACTCGAGTTTGCGTTTCAGCTTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004457.3-2641s21c1
Sequence:CCGGACAGTGAGCTCAGATCAAATACTCGAGTATTTGATCTGAGCTCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004457.3-1282s21c1
Sequence:CCGGGCCCTCAGATATTGCAGTAATCTCGAGATTACTGCAATATCTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004457.3-698s21c1
Sequence:CCGGCCTGGATGTGATACTTTAGATCTCGAGATCTAAAGTATCACATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004457.3-2748s21c1
Sequence:CCGGTTAACTGACAGGATTAGTAAACTCGAGTTTACTAATCCTGTCAGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004457.3-2392s21c1
Sequence:CCGGGCTGTGTAACAGTTGTGAAATCTCGAGATTTCACAACTGTTACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004457
VALIDATED
ACSL3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase long-chain family member 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-1282s1c1
Sequence:CCGGGCCCTCAGATATTGCAGTAATCTCGAGATTACTGCAATATCTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-2582s1c1
Sequence:CCGGGCGGACATTGAGCGAATGTATCTCGAGATACATTCGCTCAATGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-2392s1c1
Sequence:CCGGGCTGTGTAACAGTTGTGAAATCTCGAGATTTCACAACTGTTACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-698s1c1
Sequence:CCGGCCTGGATGTGATACTTTAGATCTCGAGATCTAAAGTATCACATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-2540s1c1
Sequence:CCGGGCCTTCAAGCTGAAACGCAAACTCGAGTTTGCGTTTCAGCTTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004457.3-2641s21c1
Sequence:CCGGACAGTGAGCTCAGATCAAATACTCGAGTATTTGATCTGAGCTCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004457.3-1282s21c1
Sequence:CCGGGCCCTCAGATATTGCAGTAATCTCGAGATTACTGCAATATCTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004457.3-698s21c1
Sequence:CCGGCCTGGATGTGATACTTTAGATCTCGAGATCTAAAGTATCACATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004457.3-2748s21c1
Sequence:CCGGTTAACTGACAGGATTAGTAAACTCGAGTTTACTAATCCTGTCAGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004457.3-2392s21c1
Sequence:CCGGGCTGTGTAACAGTTGTGAAATCTCGAGATTTCACAACTGTTACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004457
VALIDATED
ACSL3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase long-chain family member 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-1282s1c1
Sequence:CCGGGCCCTCAGATATTGCAGTAATCTCGAGATTACTGCAATATCTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-2582s1c1
Sequence:CCGGGCGGACATTGAGCGAATGTATCTCGAGATACATTCGCTCAATGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-2392s1c1
Sequence:CCGGGCTGTGTAACAGTTGTGAAATCTCGAGATTTCACAACTGTTACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-698s1c1
Sequence:CCGGCCTGGATGTGATACTTTAGATCTCGAGATCTAAAGTATCACATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004457.3-2540s1c1
Sequence:CCGGGCCTTCAAGCTGAAACGCAAACTCGAGTTTGCGTTTCAGCTTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004457.3-2641s21c1
Sequence:CCGGACAGTGAGCTCAGATCAAATACTCGAGTATTTGATCTGAGCTCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004457.3-1282s21c1
Sequence:CCGGGCCCTCAGATATTGCAGTAATCTCGAGATTACTGCAATATCTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004457.3-698s21c1
Sequence:CCGGCCTGGATGTGATACTTTAGATCTCGAGATCTAAAGTATCACATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004457.3-2748s21c1
Sequence:CCGGTTAACTGACAGGATTAGTAAACTCGAGTTTACTAATCCTGTCAGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004457.3-2392s21c1
Sequence:CCGGGCTGTGTAACAGTTGTGAAATCTCGAGATTTCACAACTGTTACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)