EMAIL THIS PAGE TO A FRIEND

ACSL4

acyl-CoA synthetase long-chain family member 4

264 Gene Product Result for
Synonyms: ACS4 FACL4 LACS4 MRX63 MRX68
UniProtKB ID: O60488, D3DUY2, O60848, O60849
Gene ID:
Human(2182) Summary: The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme preferentially utilizes arachidonate as substrate. The absence of this enzyme may contribute to the mental retardation or Alport syndrome. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Mouse(50790) acyl-CoA synthetase long-chain family member 4
Rat(113976) acyl-CoA synthetase long-chain family member 4
chicken(422345) acyl-CoA synthetase long-chain family member 4
cow(536628) acyl-CoA synthetase long-chain family member 4
Horse(100054459) acyl-CoA synthetase long-chain family member 4
domestic cat(101090925) acyl-CoA synthetase long-chain family member 4
dog(481018) acyl-CoA synthetase long-chain family member 4
sheep(101111781) acyl-CoA synthetase long-chain family member 4
Domestic Rabbit(100342485) acyl-CoA synthetase long-chain family member 4
naked mole-rat(101717258) acyl-CoA synthetase long-chain family member 4
domestic guinea pig(100722621) acyl-CoA synthetase long-chain family member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004458 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004458 Rosetta Predictions human pricing
NM_022977 Rosetta Predictions human pricing
NM_053623 Rosetta Predictions rat pricing
NM_001033600 Rosetta Predictions mouse pricing
NM_019477 Rosetta Predictions mouse pricing
NM_207625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114667 predicted 1030
2 SASI_Hs02_00337648 predicted 1622
3 SASI_Hs01_00114668 predicted 1961
4 SASI_Hs01_00114669 predicted 1882
5 SASI_Hs01_00114670 predicted 2292
6 SASI_Hs01_00114671 predicted 2087
7 SASI_Hs01_00114672 predicted 2165
8 SASI_Hs01_00114673 predicted 1916
9 SASI_Hs01_00114674 predicted 596
10 SASI_Hs01_00114675 predicted 918
11 SASI_Hs01_00114666 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155370 predicted 1335
2 SASI_Hs02_00356251 predicted 1935
3 SASI_Hs01_00155371 predicted 2276
4 SASI_Hs01_00155372 predicted 2199
5 SASI_Hs01_00155373 predicted 2600
6 SASI_Hs01_00155374 predicted 2393
7 SASI_Hs01_00155375 predicted 2472
8 SASI_Hs01_00155376 predicted 2224
9 SASI_Hs01_00155377 predicted 901
10 SASI_Hs01_00155378 predicted 1226
11 SASI_Hs01_00155369 predicted 1901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041844 predicted 440
2 SASI_Rn01_00041845 predicted 1184
3 SASI_Rn01_00041846 predicted 1574
4 SASI_Rn01_00041847 predicted 697
5 SASI_Rn01_00041849 predicted 1488
6 SASI_Rn01_00041850 predicted 1958
7 SASI_Rn01_00041851 predicted 2043
8 SASI_Rn01_00041852 predicted 1752
9 SASI_Rn01_00041853 predicted 285
10 SASI_Rn02_00266329 predicted 1218
11 SASI_Rn01_00041848 predicted 2037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055806 predicted 2353
2 SASI_Mm01_00055807 predicted 1676
3 SASI_Mm02_00288931 predicted 1020
4 SASI_Mm01_00055808 predicted 1870
5 SASI_Mm01_00055810 predicted 2142
6 SASI_Mm01_00055811 predicted 2057
7 SASI_Mm02_00288932 predicted 1598
8 SASI_Mm01_00055812 predicted 1149
9 SASI_Mm01_00055813 predicted 1372
10 SASI_Mm01_00055814 predicted 1937
11 SASI_Mm01_00055809 predicted 1330
12 SASI_Mm01_00055815 predicted 1862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126927 predicted 2354
2 SASI_Mm01_00126928 predicted 1685
3 SASI_Mm02_00324478 predicted 1026
4 SASI_Mm01_00126929 predicted 1882
5 SASI_Mm01_00126931 predicted 2140
6 SASI_Mm01_00126932 predicted 2066
7 SASI_Mm02_00324479 predicted 1597
8 SASI_Mm01_00126933 predicted 1155
9 SASI_Mm01_00126934 predicted 1372
10 SASI_Mm01_00126935 predicted 1935
11 SASI_Mm01_00126930 predicted 1337
12 SASI_Mm01_00126936 predicted 1861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089861 predicted 2652
2 SASI_Mm01_00089862 predicted 1971
3 SASI_Mm02_00352143 predicted 1313
4 SASI_Mm01_00089863 predicted 2169
5 SASI_Mm01_00089865 predicted 2428
6 SASI_Mm01_00089866 predicted 2348
7 SASI_Mm02_00352144 predicted 1886
8 SASI_Mm01_00089867 predicted 1444
9 SASI_Mm01_00089868 predicted 1664
10 SASI_Mm01_00089869 predicted 2231
11 SASI_Mm01_00089864 predicted 1629
12 SASI_Mm01_00089870 predicted 2155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019477
VALIDATED
ACSL4 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase long-chain family member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019477.3-2670s21c1
Sequence:CCGGCCTAGTTCAGAAGTTTCTATACTCGAGTATAGAAACTTCTGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-2145s21c1
Sequence:CCGGGCCATGAAATTGGAGCGATTTCTCGAGAAATCGCTCCAATTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-568s21c1
Sequence:CCGGGCAGAGTGAATAACTTTGGAACTCGAGTTCCAAAGTTATTCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-1782s21c1
Sequence:CCGGGCAGAAGATTATTGTGTTGATCTCGAGATCAACACAATAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-1330s21c1
Sequence:CCGGGCAAGGTTCAAGAGATGAATTCTCGAGAATTCATCTCTTGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-2640s1c1
Sequence:CCGGCCTAGTTCAGAAGTTTCTATACTCGAGTATAGAAACTTCTGAACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-1752s1c1
Sequence:CCGGGCAGAAGATTATTGTGTTGATCTCGAGATCAACACAATAATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-2115s1c1
Sequence:CCGGGCCATGAAATTGGAGCGATTTCTCGAGAAATCGCTCCAATTTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-538s1c1
Sequence:CCGGGCAGAGTGAATAACTTTGGAACTCGAGTTCCAAAGTTATTCACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019477.2-1300s1c1
Sequence:CCGGGCAAGGTTCAAGAGATGAATTCTCGAGAATTCATCTCTTGAACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019477
VALIDATED
ACSL4 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase long-chain family member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019477.3-2670s21c1
Sequence:CCGGCCTAGTTCAGAAGTTTCTATACTCGAGTATAGAAACTTCTGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-2145s21c1
Sequence:CCGGGCCATGAAATTGGAGCGATTTCTCGAGAAATCGCTCCAATTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-568s21c1
Sequence:CCGGGCAGAGTGAATAACTTTGGAACTCGAGTTCCAAAGTTATTCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-1782s21c1
Sequence:CCGGGCAGAAGATTATTGTGTTGATCTCGAGATCAACACAATAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-1330s21c1
Sequence:CCGGGCAAGGTTCAAGAGATGAATTCTCGAGAATTCATCTCTTGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-2640s1c1
Sequence:CCGGCCTAGTTCAGAAGTTTCTATACTCGAGTATAGAAACTTCTGAACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-1752s1c1
Sequence:CCGGGCAGAAGATTATTGTGTTGATCTCGAGATCAACACAATAATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-2115s1c1
Sequence:CCGGGCCATGAAATTGGAGCGATTTCTCGAGAAATCGCTCCAATTTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-538s1c1
Sequence:CCGGGCAGAGTGAATAACTTTGGAACTCGAGTTCCAAAGTTATTCACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019477.2-1300s1c1
Sequence:CCGGGCAAGGTTCAAGAGATGAATTCTCGAGAATTCATCTCTTGAACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019477
VALIDATED
ACSL4 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase long-chain family member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019477.3-2670s21c1
Sequence:CCGGCCTAGTTCAGAAGTTTCTATACTCGAGTATAGAAACTTCTGAACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-2145s21c1
Sequence:CCGGGCCATGAAATTGGAGCGATTTCTCGAGAAATCGCTCCAATTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-568s21c1
Sequence:CCGGGCAGAGTGAATAACTTTGGAACTCGAGTTCCAAAGTTATTCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-1782s21c1
Sequence:CCGGGCAGAAGATTATTGTGTTGATCTCGAGATCAACACAATAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019477.3-1330s21c1
Sequence:CCGGGCAAGGTTCAAGAGATGAATTCTCGAGAATTCATCTCTTGAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-2640s1c1
Sequence:CCGGCCTAGTTCAGAAGTTTCTATACTCGAGTATAGAAACTTCTGAACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-1752s1c1
Sequence:CCGGGCAGAAGATTATTGTGTTGATCTCGAGATCAACACAATAATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-2115s1c1
Sequence:CCGGGCCATGAAATTGGAGCGATTTCTCGAGAAATCGCTCCAATTTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019477.2-538s1c1
Sequence:CCGGGCAGAGTGAATAACTTTGGAACTCGAGTTCCAAAGTTATTCACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019477.2-1300s1c1
Sequence:CCGGGCAAGGTTCAAGAGATGAATTCTCGAGAATTCATCTCTTGAACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004458
VALIDATED
ACSL4 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase long-chain family member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004458.1-1317s1c1
Sequence:CCGGCCGGAAATCATGGATAGAATTCTCGAGAATTCTATCCATGATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_004458.1-1929s1c1
Sequence:CCGGGCAGGAGAGTATGTATCTCTTCTCGAGAAGAGATACATACTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004458.1-756s1c1
Sequence:CCGGGCAGTAGTTCATGGGCTAAATCTCGAGATTTAGCCCATGAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004458.1-802s1c1
Sequence:CCGGCCAGTGTTGAACTTCTGGAAACTCGAGTTTCCAGAAGTTCAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004458.1-2294s1c1
Sequence:CCGGCCTCAAAGACATTGAACGAATCTCGAGATTCGTTCAATGTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004458
VALIDATED
ACSL4 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase long-chain family member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004458.1-1317s1c1
Sequence:CCGGCCGGAAATCATGGATAGAATTCTCGAGAATTCTATCCATGATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_004458.1-1929s1c1
Sequence:CCGGGCAGGAGAGTATGTATCTCTTCTCGAGAAGAGATACATACTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004458.1-756s1c1
Sequence:CCGGGCAGTAGTTCATGGGCTAAATCTCGAGATTTAGCCCATGAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004458.1-802s1c1
Sequence:CCGGCCAGTGTTGAACTTCTGGAAACTCGAGTTTCCAGAAGTTCAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004458.1-2294s1c1
Sequence:CCGGCCTCAAAGACATTGAACGAATCTCGAGATTCGTTCAATGTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004458
VALIDATED
ACSL4 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase long-chain family member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004458.1-1317s1c1
Sequence:CCGGCCGGAAATCATGGATAGAATTCTCGAGAATTCTATCCATGATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_004458.1-1929s1c1
Sequence:CCGGGCAGGAGAGTATGTATCTCTTCTCGAGAAGAGATACATACTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004458.1-756s1c1
Sequence:CCGGGCAGTAGTTCATGGGCTAAATCTCGAGATTTAGCCCATGAACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004458.1-802s1c1
Sequence:CCGGCCAGTGTTGAACTTCTGGAAACTCGAGTTTCCAGAAGTTCAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004458.1-2294s1c1
Sequence:CCGGCCTCAAAGACATTGAACGAATCTCGAGATTCGTTCAATGTCTTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks