EMAIL THIS PAGE TO A FRIEND

ACSL5

acyl-CoA synthetase long-chain family member 5

109 Gene Product Result for
Synonyms: ACS2 ACS5 FACL5
UniProtKB ID: Q9ULC5, D3DRB3, Q6UX44, Q9UIU4
Gene ID:
Human(51703) Summary: The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in uterus and spleen, and in trace amounts in normal brain, but has markedly increased levels in malignant gliomas. This gene functions in mediating fatty acid-induced glioma cell growth. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(433256) acyl-CoA synthetase long-chain family member 5
Rat(94340) acyl-CoA synthetase long-chain family member 5
Zebrafish(447860) acyl-CoA synthetase long-chain family member 5
cow(514159) acyl-CoA synthetase long-chain family member 5
Horse(100059190) acyl-CoA synthetase long-chain family member 5
domestic cat(101101342) acyl-CoA synthetase long-chain family member 5
dog(477820) acyl-CoA synthetase long-chain family member 5
chicken(423896) acyl-CoA synthetase long-chain family member 5
domestic guinea pig(100379229) acyl-CoA synthetase long-chain family member 5
naked mole-rat(101720490) acyl-CoA synthetase long-chain family member 5
sheep(101121475) acyl-CoA synthetase long-chain family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016234 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016234 Rosetta Predictions human pricing
NM_203379 Rosetta Predictions human pricing
NM_203380 Rosetta Predictions human pricing
NM_053607 Rosetta Predictions rat pricing
NM_027976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349104 predicted 1349
2 SASI_Hs01_00046718 predicted 2117
3 SASI_Hs01_00046719 predicted 1876
4 SASI_Hs01_00046720 predicted 467
5 SASI_Hs01_00046724 predicted 849
6 SASI_Hs02_00349105 predicted 1587
7 SASI_Hs01_00046725 predicted 717
8 SASI_Hs01_00046727 predicted 725
9 SASI_Hs02_00349106 predicted 1755
10 SASI_Hs02_00349107 predicted 2057
11 SASI_Hs01_00046721 predicted 951
12 SASI_Hs01_00046722 predicted 1206
13 SASI_Hs01_00046723 predicted 1205
14 SASI_Hs01_00046726 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227109 predicted 1202
2 SASI_Hs01_00227110 predicted 1973
3 SASI_Hs01_00227111 predicted 1738
4 SASI_Hs01_00227112 predicted 333
5 SASI_Hs01_00227114 predicted 712
6 SASI_Hs01_00227115 predicted 1450
7 SASI_Hs01_00227116 predicted 581
8 SASI_Hs01_00227117 predicted 584
9 SASI_Hs01_00227118 predicted 1612
10 SASI_Hs02_00373314 predicted 1918
11 SASI_Hs01_00227113 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147302 predicted 1376
2 SASI_Hs01_00147303 predicted 2140
3 SASI_Hs01_00147304 predicted 1909
4 SASI_Hs01_00147305 predicted 501
5 SASI_Hs01_00147307 predicted 876
6 SASI_Hs01_00147308 predicted 1622
7 SASI_Hs01_00147309 predicted 744
8 SASI_Hs01_00147310 predicted 754
9 SASI_Hs01_00147311 predicted 1783
10 SASI_Hs02_00373315 predicted 2087
11 SASI_Hs01_00147306 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062193 predicted 1041
2 SASI_Rn01_00062194 predicted 2092
3 SASI_Rn01_00062195 predicted 778
4 SASI_Rn01_00062196 predicted 803
5 SASI_Rn01_00062197 predicted 792
6 SASI_Rn01_00062198 predicted 1847
7 SASI_Rn01_00062200 predicted 310
8 SASI_Rn01_00062201 predicted 1244
9 SASI_Rn01_00062202 predicted 1503
10 SASI_Rn02_00266308 predicted 875
11 SASI_Rn01_00062199 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070122 predicted 1631
2 SASI_Mm01_00070123 predicted 1958
3 SASI_Mm01_00070124 predicted 2744
4 SASI_Mm02_00333022 predicted 2808
5 SASI_Mm01_00070125 predicted 1021
6 SASI_Mm01_00070127 predicted 2299
7 SASI_Mm01_00070128 predicted 1889
8 SASI_Mm01_00070130 predicted 1214
9 SASI_Mm01_00070131 predicted 1732
10 SASI_Mm02_00333023 predicted 1579
11 SASI_Mm01_00070126 predicted 2594
12 SASI_Mm01_00070129 predicted 2420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016234
ACSL5 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase long-chain family member 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-2280s1c1
Sequence:CCGGCCAAATACTTTCGGACCCAAACTCGAGTTTGGGTCCGAAAGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-2116s1c1
Sequence:CCGGCCAAGTTGTAAGGGAAGCCATCTCGAGATGGCTTCCCTTACAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-1202s1c1
Sequence:CCGGGCTCATATGTTTGAGAGGATTCTCGAGAATCCTCTCAAACATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-1456s1c1
Sequence:CCGGGCATGATAGTTTCTGGGACAACTCGAGTTGTCCCAGAAACTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-398s1c1
Sequence:CCGGCCTCTTCTTGACCTGAACAATCTCGAGATTGTTCAGGTCAAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016234.3-1508s21c1
Sequence:CCGGGGCGGAAGGGTTCGTGTAATTCTCGAGAATTACACGAACCCTTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016234.3-2530s21c1
Sequence:CCGGTCTTCGATGTTGCTAATATTACTCGAGTAATATTAGCAACATCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016234.3-954s21c1
Sequence:CCGGAGAGTGGAATTGAGATCTTATCTCGAGATAAGATCTCAATTCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016234
ACSL5 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase long-chain family member 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-2280s1c1
Sequence:CCGGCCAAATACTTTCGGACCCAAACTCGAGTTTGGGTCCGAAAGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-2116s1c1
Sequence:CCGGCCAAGTTGTAAGGGAAGCCATCTCGAGATGGCTTCCCTTACAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-1202s1c1
Sequence:CCGGGCTCATATGTTTGAGAGGATTCTCGAGAATCCTCTCAAACATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-1456s1c1
Sequence:CCGGGCATGATAGTTTCTGGGACAACTCGAGTTGTCCCAGAAACTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-398s1c1
Sequence:CCGGCCTCTTCTTGACCTGAACAATCTCGAGATTGTTCAGGTCAAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016234.3-1508s21c1
Sequence:CCGGGGCGGAAGGGTTCGTGTAATTCTCGAGAATTACACGAACCCTTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016234.3-2530s21c1
Sequence:CCGGTCTTCGATGTTGCTAATATTACTCGAGTAATATTAGCAACATCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016234.3-954s21c1
Sequence:CCGGAGAGTGGAATTGAGATCTTATCTCGAGATAAGATCTCAATTCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016234
ACSL5 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase long-chain family member 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-2280s1c1
Sequence:CCGGCCAAATACTTTCGGACCCAAACTCGAGTTTGGGTCCGAAAGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-2116s1c1
Sequence:CCGGCCAAGTTGTAAGGGAAGCCATCTCGAGATGGCTTCCCTTACAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-1202s1c1
Sequence:CCGGGCTCATATGTTTGAGAGGATTCTCGAGAATCCTCTCAAACATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-1456s1c1
Sequence:CCGGGCATGATAGTTTCTGGGACAACTCGAGTTGTCCCAGAAACTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016234.3-398s1c1
Sequence:CCGGCCTCTTCTTGACCTGAACAATCTCGAGATTGTTCAGGTCAAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016234.3-1508s21c1
Sequence:CCGGGGCGGAAGGGTTCGTGTAATTCTCGAGAATTACACGAACCCTTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016234.3-2530s21c1
Sequence:CCGGTCTTCGATGTTGCTAATATTACTCGAGTAATATTAGCAACATCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016234.3-954s21c1
Sequence:CCGGAGAGTGGAATTGAGATCTTATCTCGAGATAAGATCTCAATTCCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027976
VALIDATED
ACSL5 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase long-chain family member 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-2380s1c1
Sequence:CCGGCAGTAAATGAAGCAAGCACTACTCGAGTAGTGCTTGCTTCATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-2029s1c1
Sequence:CCGGCCAGATTCACTTCCCTCATTTCTCGAGAAATGAGGGAAGTGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-655s1c1
Sequence:CCGGGACCAATTTGTTGGCATCTTTCTCGAGAAAGATGCCAACAAATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-1607s1c1
Sequence:CCGGCAGGTGGATGTTCAATTACATCTCGAGATGTAATTGAACATCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-1318s1c1
Sequence:CCGGCGACTCCTTAACAGGGTCTATCTCGAGATAGACCCTGTTAAGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027976.2-2946s21c1
Sequence:CCGGCAGTAAATGAAGCAAGCACTACTCGAGTAGTGCTTGCTTCATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027976.2-2173s21c1
Sequence:CCGGCAGGTGGATGTTCAATTACATCTCGAGATGTAATTGAACATCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027976.2-2595s21c1
Sequence:CCGGCCAGATTCACTTCCCTCATTTCTCGAGAAATGAGGGAAGTGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027976.2-1221s21c1
Sequence:CCGGGACCAATTTGTTGGCATCTTTCTCGAGAAAGATGCCAACAAATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027976
VALIDATED
ACSL5 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase long-chain family member 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-2380s1c1
Sequence:CCGGCAGTAAATGAAGCAAGCACTACTCGAGTAGTGCTTGCTTCATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-2029s1c1
Sequence:CCGGCCAGATTCACTTCCCTCATTTCTCGAGAAATGAGGGAAGTGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-655s1c1
Sequence:CCGGGACCAATTTGTTGGCATCTTTCTCGAGAAAGATGCCAACAAATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-1607s1c1
Sequence:CCGGCAGGTGGATGTTCAATTACATCTCGAGATGTAATTGAACATCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-1318s1c1
Sequence:CCGGCGACTCCTTAACAGGGTCTATCTCGAGATAGACCCTGTTAAGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027976.2-2946s21c1
Sequence:CCGGCAGTAAATGAAGCAAGCACTACTCGAGTAGTGCTTGCTTCATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027976.2-2173s21c1
Sequence:CCGGCAGGTGGATGTTCAATTACATCTCGAGATGTAATTGAACATCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027976.2-2595s21c1
Sequence:CCGGCCAGATTCACTTCCCTCATTTCTCGAGAAATGAGGGAAGTGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027976.2-1221s21c1
Sequence:CCGGGACCAATTTGTTGGCATCTTTCTCGAGAAAGATGCCAACAAATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027976
VALIDATED
ACSL5 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase long-chain family member 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-2380s1c1
Sequence:CCGGCAGTAAATGAAGCAAGCACTACTCGAGTAGTGCTTGCTTCATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-2029s1c1
Sequence:CCGGCCAGATTCACTTCCCTCATTTCTCGAGAAATGAGGGAAGTGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-655s1c1
Sequence:CCGGGACCAATTTGTTGGCATCTTTCTCGAGAAAGATGCCAACAAATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-1607s1c1
Sequence:CCGGCAGGTGGATGTTCAATTACATCTCGAGATGTAATTGAACATCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027976.1-1318s1c1
Sequence:CCGGCGACTCCTTAACAGGGTCTATCTCGAGATAGACCCTGTTAAGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027976.2-2946s21c1
Sequence:CCGGCAGTAAATGAAGCAAGCACTACTCGAGTAGTGCTTGCTTCATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027976.2-2173s21c1
Sequence:CCGGCAGGTGGATGTTCAATTACATCTCGAGATGTAATTGAACATCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027976.2-2595s21c1
Sequence:CCGGCCAGATTCACTTCCCTCATTTCTCGAGAAATGAGGGAAGTGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027976.2-1221s21c1
Sequence:CCGGGACCAATTTGTTGGCATCTTTCTCGAGAAAGATGCCAACAAATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks