EMAIL THIS PAGE TO A FRIEND

ACSL6

acyl-CoA synthetase long-chain family member 6

149 Gene Product Result for
Synonyms: ACS2 FACL6 LACS 6 LACS2 LACS5
Gene ID:
Human(23305) Summary: The protein encoded by this gene catalyzes the formation of acyl-CoA from fatty acids, ATP, and CoA, using magnesium as a cofactor. The encoded protein plays a major role in fatty acid metabolism in the brain. Translocations with the ETV6 gene are causes of myelodysplastic syndrome with basophilia, acute myelogenous leukemia with eosinophilia, and acute eosinophilic leukemia. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2011]
Mouse(216739) acyl-CoA synthetase long-chain family member 6
Rat(117243) acyl-CoA synthetase long-chain family member 6
sheep(101102389) acyl-CoA synthetase long-chain family member 6
Domestic Rabbit(100328719) acyl-CoA synthetase long-chain family member 6
naked mole-rat(101725324) acyl-CoA synthetase long-chain family member 6
domestic guinea pig(100718006) acyl-CoA synthetase long-chain family member 6
Zebrafish(566863) acyl-CoA synthetase long-chain family member 6
cow(506059) acyl-CoA synthetase long-chain family member 6
Horse(100063361) acyl-CoA synthetase long-chain family member 6
domestic cat(101093740) acyl-CoA synthetase long-chain family member 6
dog(474670) acyl-CoA synthetase long-chain family member 6
chicken(416324) acyl-CoA synthetase long-chain family member 6
Zebrafish(100332846) acyl-CoA synthetase long-chain family member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009185 Rosetta Predictions human pricing
NM_015256 Rosetta Predictions human pricing
NM_130739 Rosetta Predictions rat pricing
NM_001033597 Rosetta Predictions mouse pricing
NM_001033598 Rosetta Predictions mouse pricing
NM_001033599 Rosetta Predictions mouse pricing
NM_144823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085513 predicted 413
2 SASI_Hs01_00085514 predicted 2035
3 SASI_Hs01_00085515 predicted 332
4 SASI_Hs01_00085517 predicted 2084
5 SASI_Hs01_00085518 predicted 1868
6 SASI_Hs01_00085519 predicted 1383
7 SASI_Hs01_00085520 predicted 608
8 SASI_Hs01_00085521 predicted 1412
9 SASI_Hs01_00085522 predicted 2150
10 SASI_Hs02_00305610 predicted 2106
11 SASI_Hs01_00085516 predicted 1395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108368 predicted 413
2 SASI_Hs01_00108369 predicted 2037
3 SASI_Hs01_00108370 predicted 333
4 SASI_Hs01_00108372 predicted 2086
5 SASI_Hs01_00108373 predicted 1862
6 SASI_Hs01_00108374 predicted 1382
7 SASI_Hs01_00108375 predicted 609
8 SASI_Hs01_00108376 predicted 1409
9 SASI_Hs01_00108377 predicted 2155
10 SASI_Hs02_00347396 predicted 2102
11 SASI_Hs01_00108371 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079210 predicted 2101
2 SASI_Rn01_00079211 predicted 291
3 SASI_Rn01_00079212 predicted 484
4 SASI_Rn01_00079213 predicted 738
5 SASI_Rn01_00079214 predicted 1618
6 SASI_Rn01_00079215 predicted 732
7 SASI_Rn01_00079216 predicted 1850
8 SASI_Rn01_00079217 predicted 1096
9 SASI_Rn01_00079218 predicted 1663
10 SASI_Rn01_00079219 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177358 predicted 699
2 SASI_Mm01_00177359 predicted 384
3 SASI_Mm01_00177360 predicted 2128
4 SASI_Mm01_00177361 predicted 502
5 SASI_Mm01_00177362 predicted 1387
6 SASI_Mm01_00177363 predicted 1678
7 SASI_Mm01_00177364 predicted 2117
8 SASI_Mm01_00177365 predicted 1508
9 SASI_Mm01_00177366 predicted 1869
10 SASI_Mm01_00177367 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093161 predicted 666
2 SASI_Mm01_00093162 predicted 357
3 SASI_Mm01_00093163 predicted 2099
4 SASI_Mm01_00093164 predicted 466
5 SASI_Mm01_00093165 predicted 1351
6 SASI_Mm01_00093166 predicted 1649
7 SASI_Mm01_00093167 predicted 2084
8 SASI_Mm01_00093168 predicted 1481
9 SASI_Mm01_00093169 predicted 1842
10 SASI_Mm01_00093170 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074884 predicted 876
2 SASI_Mm02_00288926 predicted 558
3 SASI_Mm01_00074886 predicted 2301
4 SASI_Mm01_00074887 predicted 671
5 SASI_Mm02_00288927 predicted 1561
6 SASI_Mm01_00074889 predicted 1852
7 SASI_Mm02_00288928 predicted 2294
8 SASI_Mm01_00074892 predicted 1690
9 SASI_Mm02_00288929 predicted 2045
10 SASI_Mm02_00288930 predicted 1558
11 SASI_Mm01_00074883 predicted 487
12 SASI_Mm01_00074885 predicted 1296
13 SASI_Mm01_00074888 predicted 2259
14 SASI_Mm01_00074890 predicted 881
15 SASI_Mm01_00074891 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101326 predicted 706
2 SASI_Mm01_00101327 predicted 382
3 SASI_Mm01_00101328 predicted 2127
4 SASI_Mm01_00101329 predicted 505
5 SASI_Mm01_00101330 predicted 1388
6 SASI_Mm01_00101331 predicted 1681
7 SASI_Mm01_00101332 predicted 2119
8 SASI_Mm01_00101333 predicted 1517
9 SASI_Mm01_00101334 predicted 1872
10 SASI_Mm01_00101335 predicted 1384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015256
ACSL6 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase long-chain family member 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015256.2-2298s21c1
Sequence:CCGGTAATGAACTGTCTAGCAATATCTCGAGATATTGCTAGACAGTTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015256.2-417s21c1
Sequence:CCGGAGCTACTTACCCACTACTATGCTCGAGCATAGTAGTGGGTAAGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015256.2-2565s21c1
Sequence:CCGGCAATGTTCACAGAACTATTAACTCGAGTTAATAGTTCTGTGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015256.2-2735s21c1
Sequence:CCGGGGTGTATAGAATCATGCTAAACTCGAGTTTAGCATGATTCTATACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015256.2-1164s21c1
Sequence:CCGCTGGTGCAGTCTGTCGTCTATTCTCGAGAATAGACGACAGACTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-1251s1c1
Sequence:CCGGCCAGGCAAACACACCATTAAACTCGAGTTTAATGGTGTGTTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-667s1c1
Sequence:CCGGGCTATCCGCTACATCATCAATCTCGAGATTGATGATGTAGCGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-2067s1c1
Sequence:CCGGGCAGGTTAAAGCCATTCACATCTCGAGATGTGAATGGCTTTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-544s1c1
Sequence:CCGGGCATGCACTGATCAGTTTATTCTCGAGAATAAACTGATCAGTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-1318s1c1
Sequence:CCGGCGGAGTGGAATCATCAGGAATCTCGAGATTCCTGATGATTCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015256
ACSL6 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase long-chain family member 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015256.2-2298s21c1
Sequence:CCGGTAATGAACTGTCTAGCAATATCTCGAGATATTGCTAGACAGTTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015256.2-417s21c1
Sequence:CCGGAGCTACTTACCCACTACTATGCTCGAGCATAGTAGTGGGTAAGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015256.2-2565s21c1
Sequence:CCGGCAATGTTCACAGAACTATTAACTCGAGTTAATAGTTCTGTGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015256.2-2735s21c1
Sequence:CCGGGGTGTATAGAATCATGCTAAACTCGAGTTTAGCATGATTCTATACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015256.2-1164s21c1
Sequence:CCGCTGGTGCAGTCTGTCGTCTATTCTCGAGAATAGACGACAGACTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-1251s1c1
Sequence:CCGGCCAGGCAAACACACCATTAAACTCGAGTTTAATGGTGTGTTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-667s1c1
Sequence:CCGGGCTATCCGCTACATCATCAATCTCGAGATTGATGATGTAGCGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-2067s1c1
Sequence:CCGGGCAGGTTAAAGCCATTCACATCTCGAGATGTGAATGGCTTTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-544s1c1
Sequence:CCGGGCATGCACTGATCAGTTTATTCTCGAGAATAAACTGATCAGTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-1318s1c1
Sequence:CCGGCGGAGTGGAATCATCAGGAATCTCGAGATTCCTGATGATTCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015256
ACSL6 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase long-chain family member 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015256.2-2298s21c1
Sequence:CCGGTAATGAACTGTCTAGCAATATCTCGAGATATTGCTAGACAGTTCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015256.2-417s21c1
Sequence:CCGGAGCTACTTACCCACTACTATGCTCGAGCATAGTAGTGGGTAAGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015256.2-2565s21c1
Sequence:CCGGCAATGTTCACAGAACTATTAACTCGAGTTAATAGTTCTGTGAACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015256.2-2735s21c1
Sequence:CCGGGGTGTATAGAATCATGCTAAACTCGAGTTTAGCATGATTCTATACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015256.2-1164s21c1
Sequence:CCGCTGGTGCAGTCTGTCGTCTATTCTCGAGAATAGACGACAGACTGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-1251s1c1
Sequence:CCGGCCAGGCAAACACACCATTAAACTCGAGTTTAATGGTGTGTTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-667s1c1
Sequence:CCGGGCTATCCGCTACATCATCAATCTCGAGATTGATGATGTAGCGGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-2067s1c1
Sequence:CCGGGCAGGTTAAAGCCATTCACATCTCGAGATGTGAATGGCTTTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-544s1c1
Sequence:CCGGGCATGCACTGATCAGTTTATTCTCGAGAATAAACTGATCAGTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015256.1-1318s1c1
Sequence:CCGGCGGAGTGGAATCATCAGGAATCTCGAGATTCCTGATGATTCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144823
ACSL6 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase long-chain family member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-1863s1c1
Sequence:CCGGGCCAGAGAAGATCGAGAACATCTCGAGATGTTCTCGATCTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-1362s1c1
Sequence:CCGGGAGCGGAATCATCAGAAACAACTCGAGTTGTTTCTGATGATTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-742s1c1
Sequence:CCGGTGCACGGTAATCGTCGATAAACTCGAGTTTATCGACGATTACCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-400s1c1
Sequence:CCGGCTTACCCATTACTATGACGATCTCGAGATCGTCATAGTAATGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-1661s1c1
Sequence:CCGGGCAAAGGAGAAGGAGAGATATCTCGAGATATCTCTCCTTCTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144823
ACSL6 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase long-chain family member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-1863s1c1
Sequence:CCGGGCCAGAGAAGATCGAGAACATCTCGAGATGTTCTCGATCTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-1362s1c1
Sequence:CCGGGAGCGGAATCATCAGAAACAACTCGAGTTGTTTCTGATGATTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-742s1c1
Sequence:CCGGTGCACGGTAATCGTCGATAAACTCGAGTTTATCGACGATTACCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-400s1c1
Sequence:CCGGCTTACCCATTACTATGACGATCTCGAGATCGTCATAGTAATGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-1661s1c1
Sequence:CCGGGCAAAGGAGAAGGAGAGATATCTCGAGATATCTCTCCTTCTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144823
ACSL6 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase long-chain family member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-1863s1c1
Sequence:CCGGGCCAGAGAAGATCGAGAACATCTCGAGATGTTCTCGATCTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-1362s1c1
Sequence:CCGGGAGCGGAATCATCAGAAACAACTCGAGTTGTTTCTGATGATTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-742s1c1
Sequence:CCGGTGCACGGTAATCGTCGATAAACTCGAGTTTATCGACGATTACCGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-400s1c1
Sequence:CCGGCTTACCCATTACTATGACGATCTCGAGATCGTCATAGTAATGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144823.1-1661s1c1
Sequence:CCGGGCAAAGGAGAAGGAGAGATATCTCGAGATATCTCTCCTTCTCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks