EMAIL THIS PAGE TO A FRIEND

ACSM1

acyl-CoA synthetase medium-chain family member 1

48 Gene Product Result for
Synonyms: BUCS1 MACS1
UniProtKB ID: Q08AH1, Q08AH2, Q96A20
Gene ID:
Mouse(117147) acyl-CoA synthetase medium-chain family member 1
Rat(361638) acyl-CoA synthetase medium-chain family member 1
cow(282576) acyl-CoA synthetase medium-chain family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052956 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124371 MISSION® esiRNA esiRNA human ACSM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052956 Rosetta Predictions human pricing
NM_001108502 Rosetta Predictions rat pricing
NM_054094 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097085 predicted 968
2 SASI_Hs02_00361757 predicted 916
3 SASI_Hs02_00361758 predicted 1424
4 SASI_Hs01_00097087 predicted 1180
5 SASI_Hs02_00361759 predicted 1702
6 SASI_Hs01_00097089 predicted 259
7 SASI_Hs01_00097090 predicted 500
8 SASI_Hs01_00097091 predicted 385
9 SASI_Hs01_00097092 predicted 1352
10 SASI_Hs01_00097093 predicted 1180
11 SASI_Hs01_00097084 predicted 876
12 SASI_Hs01_00097086 predicted 1724
13 SASI_Hs01_00097088 predicted 1711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239279 predicted 307
2 SASI_Rn02_00239280 predicted 1225
3 SASI_Rn02_00239281 predicted 714
4 SASI_Rn02_00239282 predicted 629
5 SASI_Rn02_00239283 predicted 603
6 SASI_Rn02_00239284 predicted 1065
7 SASI_Rn02_00239285 predicted 377
8 SASI_Rn02_00239286 predicted 1058
9 SASI_Rn02_00239287 predicted 1074
10 SASI_Rn02_00239288 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165081 predicted 1258
2 SASI_Mm01_00165082 predicted 221
3 SASI_Mm01_00165083 predicted 587
4 SASI_Mm01_00165084 predicted 699
5 SASI_Mm01_00165085 predicted 1033
6 SASI_Mm01_00165086 predicted 1781
7 SASI_Mm01_00165087 predicted 1482
8 SASI_Mm01_00165088 predicted 967
9 SASI_Mm01_00165089 predicted 516
10 SASI_Mm01_00165090 predicted 1772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054094
ACSM1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase medium-chain family member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054094.4-1884s1c1
Sequence:CCGGGATGGAATGCAGGAAGGGTAACTCGAGTTACCCTTCCTGCATTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-700s1c1
Sequence:CCGGCCCAGACCATACTTGTATTAACTCGAGTTAATACAAGTATGGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-374s1c1
Sequence:CCGGGCCAACGTCTTTGAGCAGATTCTCGAGAATCTGCTCAAAGACGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-1725s1c1
Sequence:CCGGAGGTGGAGTTTGTTTCAGAATCTCGAGATTCTGAAACAAACTCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-667s1c1
Sequence:CCGGGCTTGATTTCTGTTCACTGATCTCGAGATCAGTGAACAGAAATCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054094
ACSM1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase medium-chain family member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054094.4-1884s1c1
Sequence:CCGGGATGGAATGCAGGAAGGGTAACTCGAGTTACCCTTCCTGCATTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-700s1c1
Sequence:CCGGCCCAGACCATACTTGTATTAACTCGAGTTAATACAAGTATGGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-374s1c1
Sequence:CCGGGCCAACGTCTTTGAGCAGATTCTCGAGAATCTGCTCAAAGACGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-1725s1c1
Sequence:CCGGAGGTGGAGTTTGTTTCAGAATCTCGAGATTCTGAAACAAACTCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-667s1c1
Sequence:CCGGGCTTGATTTCTGTTCACTGATCTCGAGATCAGTGAACAGAAATCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054094
ACSM1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase medium-chain family member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054094.4-1884s1c1
Sequence:CCGGGATGGAATGCAGGAAGGGTAACTCGAGTTACCCTTCCTGCATTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-700s1c1
Sequence:CCGGCCCAGACCATACTTGTATTAACTCGAGTTAATACAAGTATGGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-374s1c1
Sequence:CCGGGCCAACGTCTTTGAGCAGATTCTCGAGAATCTGCTCAAAGACGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-1725s1c1
Sequence:CCGGAGGTGGAGTTTGTTTCAGAATCTCGAGATTCTGAAACAAACTCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054094.4-667s1c1
Sequence:CCGGGCTTGATTTCTGTTCACTGATCTCGAGATCAGTGAACAGAAATCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052956
ACSM1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase medium-chain family member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-151s1c1
Sequence:CCGGGCTGCCGGTCTTTATCAGAATCTCGAGATTCTGATAAAGACCGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-1149s1c1
Sequence:CCGGCTTCTGCTCTACGAGAACTATCTCGAGATAGTTCTCGTAGAGCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-964s1c1
Sequence:CCGGCCAAGGTCATCATACAGACATCTCGAGATGTCTGTATGATGACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-1371s1c1
Sequence:CCGGGACCCAGAGAAGACAGCTAAACTCGAGTTTAGCTGTCTTCTCTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-180s1c1
Sequence:CCGGCCAAGATGGAATGACTATGAACTCGAGTTCATAGTCATTCCATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-261s21c1
Sequence:CCGGGAGGGCAAGAGAGGTCCAAATCTCGAGATTTGGACCTCTCTTGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-921s21c1
Sequence:CCGGGCGGGTTGTACAGTCTTTATCCTCGAGGATAAAGACTGTACAACCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-1174s21c1
Sequence:CCGGAGTCGGAAACGGGACTAATTTCTCGAGAAATTAGTCCCGTTTCCGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-522s21c1
Sequence:CCGCTATCGACTACAGTTGTCTAAACTCGAGTTTAGACAACTGTAGTCGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052956
ACSM1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase medium-chain family member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-151s1c1
Sequence:CCGGGCTGCCGGTCTTTATCAGAATCTCGAGATTCTGATAAAGACCGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-1149s1c1
Sequence:CCGGCTTCTGCTCTACGAGAACTATCTCGAGATAGTTCTCGTAGAGCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-964s1c1
Sequence:CCGGCCAAGGTCATCATACAGACATCTCGAGATGTCTGTATGATGACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-1371s1c1
Sequence:CCGGGACCCAGAGAAGACAGCTAAACTCGAGTTTAGCTGTCTTCTCTGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-180s1c1
Sequence:CCGGCCAAGATGGAATGACTATGAACTCGAGTTCATAGTCATTCCATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-261s21c1
Sequence:CCGGGAGGGCAAGAGAGGTCCAAATCTCGAGATTTGGACCTCTCTTGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-921s21c1
Sequence:CCGGGCGGGTTGTACAGTCTTTATCCTCGAGGATAAAGACTGTACAACCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-1174s21c1
Sequence:CCGGAGTCGGAAACGGGACTAATTTCTCGAGAAATTAGTCCCGTTTCCGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-522s21c1
Sequence:CCGCTATCGACTACAGTTGTCTAAACTCGAGTTTAGACAACTGTAGTCGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052956
ACSM1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase medium-chain family member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-151s1c1
Sequence:CCGGGCTGCCGGTCTTTATCAGAATCTCGAGATTCTGATAAAGACCGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-1149s1c1
Sequence:CCGGCTTCTGCTCTACGAGAACTATCTCGAGATAGTTCTCGTAGAGCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-964s1c1
Sequence:CCGGCCAAGGTCATCATACAGACATCTCGAGATGTCTGTATGATGACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-1371s1c1
Sequence:CCGGGACCCAGAGAAGACAGCTAAACTCGAGTTTAGCTGTCTTCTCTGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052956.1-180s1c1
Sequence:CCGGCCAAGATGGAATGACTATGAACTCGAGTTCATAGTCATTCCATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-261s21c1
Sequence:CCGGGAGGGCAAGAGAGGTCCAAATCTCGAGATTTGGACCTCTCTTGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-921s21c1
Sequence:CCGGGCGGGTTGTACAGTCTTTATCCTCGAGGATAAAGACTGTACAACCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-1174s21c1
Sequence:CCGGAGTCGGAAACGGGACTAATTTCTCGAGAAATTAGTCCCGTTTCCGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052956.2-522s21c1
Sequence:CCGCTATCGACTACAGTTGTCTAAACTCGAGTTTAGACAACTGTAGTCGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)