EMAIL THIS PAGE TO A FRIEND

ACSM2A

acyl-CoA synthetase medium-chain family member 2A

Synonyms: A-923A4.1 ACSM2
UniProtKB ID: Q08AH3, B3KTT9, O75202
Gene ID:
Rat(246263) acyl-CoA synthetase medium-chain family member 2A
naked mole-rat(101712192) acyl-CoA synthetase medium-chain family member 2A
dog(479822) acyl-CoA synthetase medium-chain family member 2A
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305819 ANTI-ACSM2A(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010845 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010845 Rosetta Predictions human pricing
NM_144748 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220597 predicted 648
2 SASI_Hs02_00305783 predicted 997
3 SASI_Hs01_00220598 predicted 1527
4 SASI_Hs01_00220599 predicted 1541
5 SASI_Hs01_00220600 predicted 1393
6 SASI_Hs01_00220601 predicted 1404
7 SASI_Hs01_00220602 predicted 1455
8 SASI_Hs01_00220603 predicted 1396
9 SASI_Hs02_00305784 predicted 1107
10 SASI_Hs01_00220604 predicted 667
11 SASI_Hs01_00220605 predicted 1705
12 SASI_Hs01_00220606 predicted 2079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041557 predicted 862
2 SASI_Rn01_00041558 predicted 1271
3 SASI_Rn01_00041559 predicted 1781
4 SASI_Rn01_00041560 predicted 337
5 SASI_Rn02_00268628 predicted 357
6 SASI_Rn01_00041561 predicted 1394
7 SASI_Rn01_00041562 predicted 672
8 SASI_Rn01_00041563 predicted 1491
9 SASI_Rn01_00041564 predicted 738
10 SASI_Rn01_00041565 predicted 1553
11 SASI_Rn01_00041566 predicted 933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010845
ACSM2A MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase medium-chain family member 2A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010845.1-2087s1c1
Sequence:CCGGGTACCCAAGAAAGATAGAGTTCTCGAGAACTCTATCTTTCTTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010845.1-1372s1c1
Sequence:CCGGCCAGTTATCCAATCAAGAGTACTCGAGTACTCTTGATTGGATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010845.1-1287s1c1
Sequence:CCGGCTTATGGAACCTTGGGCATTACTCGAGTAATGCCCAAGGTTCCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1971s21c1
Sequence:CCGGTGAGACATCTAAGAGACATTCCTCGAGGAATGTCTCTTAGATGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1040s21c1
Sequence:CCGGGAACATCTTGTGCTCACTTATCTCGAGATAAGTGAGCACAAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1963s21c1
Sequence:CCGGGTGCGCAGTGAGACATCTAAGCTCGAGCTTAGATGTCTCACTGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1056s21c1
Sequence:CCGGCTTATGGAACCTTGGGCATTACTCGAGTAATGCCCAAGGTTCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010845.2-2785s21c1
Sequence:CCGGCACTAACCCAGATGCATTATACTCGAGTATAATGCATCTGGGTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010845
ACSM2A MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase medium-chain family member 2A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010845.1-2087s1c1
Sequence:CCGGGTACCCAAGAAAGATAGAGTTCTCGAGAACTCTATCTTTCTTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010845.1-1372s1c1
Sequence:CCGGCCAGTTATCCAATCAAGAGTACTCGAGTACTCTTGATTGGATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010845.1-1287s1c1
Sequence:CCGGCTTATGGAACCTTGGGCATTACTCGAGTAATGCCCAAGGTTCCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1971s21c1
Sequence:CCGGTGAGACATCTAAGAGACATTCCTCGAGGAATGTCTCTTAGATGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1040s21c1
Sequence:CCGGGAACATCTTGTGCTCACTTATCTCGAGATAAGTGAGCACAAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1963s21c1
Sequence:CCGGGTGCGCAGTGAGACATCTAAGCTCGAGCTTAGATGTCTCACTGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1056s21c1
Sequence:CCGGCTTATGGAACCTTGGGCATTACTCGAGTAATGCCCAAGGTTCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010845.2-2785s21c1
Sequence:CCGGCACTAACCCAGATGCATTATACTCGAGTATAATGCATCTGGGTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010845
ACSM2A MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase medium-chain family member 2A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010845.1-2087s1c1
Sequence:CCGGGTACCCAAGAAAGATAGAGTTCTCGAGAACTCTATCTTTCTTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010845.1-1372s1c1
Sequence:CCGGCCAGTTATCCAATCAAGAGTACTCGAGTACTCTTGATTGGATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010845.1-1287s1c1
Sequence:CCGGCTTATGGAACCTTGGGCATTACTCGAGTAATGCCCAAGGTTCCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1971s21c1
Sequence:CCGGTGAGACATCTAAGAGACATTCCTCGAGGAATGTCTCTTAGATGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1040s21c1
Sequence:CCGGGAACATCTTGTGCTCACTTATCTCGAGATAAGTGAGCACAAGATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1963s21c1
Sequence:CCGGGTGCGCAGTGAGACATCTAAGCTCGAGCTTAGATGTCTCACTGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010845.2-1056s21c1
Sequence:CCGGCTTATGGAACCTTGGGCATTACTCGAGTAATGCCCAAGGTTCCATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010845.2-2785s21c1
Sequence:CCGGCACTAACCCAGATGCATTATACTCGAGTATAATGCATCTGGGTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks