EMAIL THIS PAGE TO A FRIEND

ACSM2B

acyl-CoA synthetase medium-chain family member 2B

70 Gene Product Result for
Synonyms: ACSM2 HXMA
UniProtKB ID: Q68CK6, Q86YT1
Gene ID:
cow(512227) acyl-CoA synthetase medium-chain family member 2B
domestic guinea pig(100730233) acyl-CoA synthetase medium-chain family member 2B
sheep(101120131) acyl-CoA synthetase medium-chain family member 2B
Domestic Rabbit(100342192) acyl-CoA synthetase medium-chain family member 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182617 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105069 Rosetta Predictions human pricing
NM_182617 Rosetta Predictions human pricing
XM_001724180 Rosetta Predictions human pricing
XM_001724186 Rosetta Predictions human pricing
XM_001724187 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323854 predicted 961
2 SASI_Hs02_00323855 predicted 586
3 SASI_Hs02_00323856 predicted 1000
4 SASI_Hs02_00323857 predicted 931
5 SASI_Hs02_00323858 predicted 1462
6 SASI_Hs02_00323859 predicted 1333
7 SASI_Hs02_00323860 predicted 1708
8 SASI_Hs02_00323861 predicted 1396
9 SASI_Hs02_00323862 predicted 1038
10 SASI_Hs02_00323863 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370754 predicted 995
2 SASI_Hs01_00081429 predicted 620
3 SASI_Hs02_00370755 predicted 1035
4 SASI_Hs02_00370756 predicted 963
5 SASI_Hs01_00081431 predicted 1494
6 SASI_Hs01_00081432 predicted 1367
7 SASI_Hs01_00081433 predicted 1744
8 SASI_Hs01_00081435 predicted 1430
9 SASI_Hs02_00370757 predicted 1070
10 SASI_Hs01_00081436 predicted 642
11 SASI_Hs01_00081430 predicted 1405
12 SASI_Hs01_00081434 predicted 1442
13 SASI_Hs01_00081437 predicted 1378
14 SASI_Hs01_00081438 predicted 1760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00459980 predicted 1372
2 SASI_Hs02_00459981 predicted 332
3 SASI_Hs02_00459982 predicted 614
4 SASI_Hs02_00459983 predicted 1031
5 SASI_Hs02_00459984 predicted 961
6 SASI_Hs02_00459985 predicted 1365
7 SASI_Hs02_00459986 predicted 984
8 SASI_Hs02_00459987 predicted 1483
9 SASI_Hs02_00459988 predicted 307
10 SASI_Hs02_00459989 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00460024 predicted 1409
2 SASI_Hs02_00460025 predicted 646
3 SASI_Hs02_00460026 predicted 1060
4 SASI_Hs02_00460027 predicted 995
5 SASI_Hs02_00460028 predicted 1404
6 SASI_Hs02_00460029 predicted 1025
7 SASI_Hs02_00460030 predicted 1525
8 SASI_Hs02_00460031 predicted 1777
9 SASI_Hs02_00460032 predicted 1393
10 SASI_Hs02_00460033 predicted 1466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00460034 predicted 1636
2 SASI_Hs02_00460035 predicted 882
3 SASI_Hs02_00460036 predicted 1290
4 SASI_Hs02_00460037 predicted 1223
5 SASI_Hs02_00460038 predicted 1632
6 SASI_Hs02_00460039 predicted 1256
7 SASI_Hs02_00460040 predicted 1748
8 SASI_Hs02_00460041 predicted 2000
9 SASI_Hs02_00460042 predicted 1627
10 SASI_Hs02_00460043 predicted 1697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182617
ACSM2B MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase medium-chain family member 2B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182617.3-1079s21c1
Sequence:CCGGAGTTTGACCCACTGGTTATTCCTCGAGGAATAACCAGTGGGTCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182617.3-1589s21c1
Sequence:CCGGGACGGGCAGATGATATCATTACTCGAGTAATGATATCATCTGCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-1097s1c1
Sequence:CCGGCGGGATTAACTTGCATGGTTTCTCGAGAAACCATGCAAGTTAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-933s1c1
Sequence:CCGGCCCTATTGTTTACCGGATGTTCTCGAGAACATCCGGTAAACAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-960s1c1
Sequence:CCGGGCAGGATCTTTCCAGTTACAACTCGAGTTGTAACTGGAAAGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-414s1c1
Sequence:CCGGCCAGATGAAATCCGCTGACATCTCGAGATGTCAGCGGATTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-122s1c1
Sequence:CCGGCGGCCAAGTTTAACCTTGCTACTCGAGTAGCAAGGTTAAACTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182617
ACSM2B MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase medium-chain family member 2B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182617.3-1079s21c1
Sequence:CCGGAGTTTGACCCACTGGTTATTCCTCGAGGAATAACCAGTGGGTCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182617.3-1589s21c1
Sequence:CCGGGACGGGCAGATGATATCATTACTCGAGTAATGATATCATCTGCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-1097s1c1
Sequence:CCGGCGGGATTAACTTGCATGGTTTCTCGAGAAACCATGCAAGTTAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-933s1c1
Sequence:CCGGCCCTATTGTTTACCGGATGTTCTCGAGAACATCCGGTAAACAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-960s1c1
Sequence:CCGGGCAGGATCTTTCCAGTTACAACTCGAGTTGTAACTGGAAAGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-414s1c1
Sequence:CCGGCCAGATGAAATCCGCTGACATCTCGAGATGTCAGCGGATTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-122s1c1
Sequence:CCGGCGGCCAAGTTTAACCTTGCTACTCGAGTAGCAAGGTTAAACTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182617
ACSM2B MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase medium-chain family member 2B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182617.3-1079s21c1
Sequence:CCGGAGTTTGACCCACTGGTTATTCCTCGAGGAATAACCAGTGGGTCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182617.3-1589s21c1
Sequence:CCGGGACGGGCAGATGATATCATTACTCGAGTAATGATATCATCTGCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-1097s1c1
Sequence:CCGGCGGGATTAACTTGCATGGTTTCTCGAGAAACCATGCAAGTTAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-933s1c1
Sequence:CCGGCCCTATTGTTTACCGGATGTTCTCGAGAACATCCGGTAAACAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-960s1c1
Sequence:CCGGGCAGGATCTTTCCAGTTACAACTCGAGTTGTAACTGGAAAGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-414s1c1
Sequence:CCGGCCAGATGAAATCCGCTGACATCTCGAGATGTCAGCGGATTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182617.1-122s1c1
Sequence:CCGGCGGCCAAGTTTAACCTTGCTACTCGAGTAGCAAGGTTAAACTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks