EMAIL THIS PAGE TO A FRIEND

ACSM3

acyl-CoA synthetase medium-chain family member 3

86 Gene Product Result for
Synonyms: SA SAH
UniProtKB ID: Q53FZ2, O60363, Q13732, Q15425, Q7KYM6, Q9BUA2
Gene ID:
Mouse(20216) acyl-CoA synthetase medium-chain family member 3
Rat(24763) acyl-CoA synthetase medium-chain family member 3
sheep(101121307) acyl-CoA synthetase medium-chain family member 3
domestic guinea pig(100736064) acyl-CoA synthetase medium-chain family member 3
naked mole-rat(101703873) acyl-CoA synthetase medium-chain family member 3
Zebrafish(100002035) acyl-CoA synthetase medium-chain family member 3
dog(608888) acyl-CoA synthetase medium-chain family member 3
domestic cat(101082455) acyl-CoA synthetase medium-chain family member 3
cow(533798) acyl-CoA synthetase medium-chain family member 3
Horse(100068672) acyl-CoA synthetase medium-chain family member 3
chicken(426999) acyl-CoA synthetase medium-chain family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005622 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005622 Rosetta Predictions human pricing
NM_202000 Rosetta Predictions human pricing
NM_033231 Rosetta Predictions rat pricing
NM_016870 Rosetta Predictions mouse pricing
NM_212441 Rosetta Predictions mouse pricing
NM_212442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180185 predicted 647
2 SASI_Hs01_00180186 predicted 1008
3 SASI_Hs01_00180187 predicted 1066
4 SASI_Hs01_00180188 predicted 1173
5 SASI_Hs01_00180189 predicted 298
6 SASI_Hs01_00180190 predicted 1169
7 SASI_Hs01_00180192 predicted 971
8 SASI_Hs01_00180193 predicted 660
9 SASI_Hs01_00180194 predicted 648
10 SASI_Hs02_00339947 predicted 311
11 SASI_Hs01_00180191 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_202000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227869 predicted 654
2 SASI_Hs01_00227870 predicted 1012
3 SASI_Hs01_00227871 predicted 1065
4 SASI_Hs01_00227872 predicted 1178
5 SASI_Hs01_00227873 predicted 295
6 SASI_Hs01_00227874 predicted 1165
7 SASI_Hs01_00227876 predicted 972
8 SASI_Hs01_00227877 predicted 659
9 SASI_Hs01_00227878 predicted 651
10 SASI_Hs02_00373179 predicted 314
11 SASI_Hs01_00227875 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114796 predicted 1913
2 SASI_Rn02_00265511 predicted 1097
3 SASI_Rn01_00114797 predicted 1758
4 SASI_Rn01_00114799 predicted 2010
5 SASI_Rn01_00114800 predicted 808
6 SASI_Rn01_00114801 predicted 1690
7 SASI_Rn01_00114802 predicted 422
8 SASI_Rn02_00265512 predicted 577
9 SASI_Rn01_00114804 predicted 1333
10 SASI_Rn01_00114805 predicted 1834
11 SASI_Rn01_00114798 predicted 1377
12 SASI_Rn01_00114803 predicted 1616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323663 predicted 1893
2 SASI_Mm01_00162055 predicted 2102
3 SASI_Mm01_00162056 predicted 935
4 SASI_Mm01_00162058 predicted 1808
5 SASI_Mm01_00162059 predicted 1475
6 SASI_Mm01_00162060 predicted 769
7 SASI_Mm02_00323664 predicted 515
8 SASI_Mm01_00162061 predicted 1287
9 SASI_Mm01_00162062 predicted 1879
10 SASI_Mm01_00162063 predicted 1549
11 SASI_Mm01_00162057 predicted 2250
12 SASI_Mm01_00162064 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352255 predicted 1789
2 SASI_Mm01_00020526 predicted 1998
3 SASI_Mm01_00020527 predicted 833
4 SASI_Mm01_00020529 predicted 1697
5 SASI_Mm01_00020530 predicted 1376
6 SASI_Mm01_00020531 predicted 671
7 SASI_Mm02_00352256 predicted 414
8 SASI_Mm01_00020532 predicted 1188
9 SASI_Mm01_00020533 predicted 1775
10 SASI_Mm01_00020534 predicted 1447
11 SASI_Mm01_00020528 predicted 2144
12 SASI_Mm01_00020535 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352257 predicted 1687
2 SASI_Mm01_00201637 predicted 1899
3 SASI_Mm01_00201638 predicted 742
4 SASI_Mm01_00201640 predicted 1605
5 SASI_Mm01_00201641 predicted 1278
6 SASI_Mm01_00201642 predicted 573
7 SASI_Mm02_00352258 predicted 309
8 SASI_Mm01_00201643 predicted 1085
9 SASI_Mm01_00201644 predicted 1679
10 SASI_Mm01_00201645 predicted 1354
11 SASI_Mm01_00201639 predicted 2051
12 SASI_Mm01_00201646 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016870
ACSM3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase medium-chain family member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016870.2-2366s1c1
Sequence:CCGGGCTCCTGTAATCTGCCAACATCTCGAGATGTTGGCAGATTACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-1231s1c1
Sequence:CCGGCCGATGTGATGTGGAATACTTCTCGAGAAGTATTCCACATCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-973s1c1
Sequence:CCGGCCGTGGCAGCTAAATGTGAAACTCGAGTTTCACATTTAGCTGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-2091s1c1
Sequence:CCGGCCCAGAAAGGTAGAATTTATTCTCGAGAATAAATTCTACCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-1441s1c1
Sequence:CCGGGCAGCTATAAGTTCAACAGTTCTCGAGAACTGTTGAACTTATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016870
ACSM3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase medium-chain family member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016870.2-2366s1c1
Sequence:CCGGGCTCCTGTAATCTGCCAACATCTCGAGATGTTGGCAGATTACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-1231s1c1
Sequence:CCGGCCGATGTGATGTGGAATACTTCTCGAGAAGTATTCCACATCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-973s1c1
Sequence:CCGGCCGTGGCAGCTAAATGTGAAACTCGAGTTTCACATTTAGCTGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-2091s1c1
Sequence:CCGGCCCAGAAAGGTAGAATTTATTCTCGAGAATAAATTCTACCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-1441s1c1
Sequence:CCGGGCAGCTATAAGTTCAACAGTTCTCGAGAACTGTTGAACTTATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016870
ACSM3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase medium-chain family member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016870.2-2366s1c1
Sequence:CCGGGCTCCTGTAATCTGCCAACATCTCGAGATGTTGGCAGATTACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-1231s1c1
Sequence:CCGGCCGATGTGATGTGGAATACTTCTCGAGAAGTATTCCACATCACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-973s1c1
Sequence:CCGGCCGTGGCAGCTAAATGTGAAACTCGAGTTTCACATTTAGCTGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-2091s1c1
Sequence:CCGGCCCAGAAAGGTAGAATTTATTCTCGAGAATAAATTCTACCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016870.2-1441s1c1
Sequence:CCGGGCAGCTATAAGTTCAACAGTTCTCGAGAACTGTTGAACTTATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005622
ACSM3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase medium-chain family member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-385s1c1
Sequence:CCGGGCTGGAAAGAAACCTTCAAATCTCGAGATTTGAAGGTTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-1747s1c1
Sequence:CCGGCCTGATTACAAGTCACATGATCTCGAGATCATGTGACTTGTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-967s1c1
Sequence:CCGGCCCTCAGATGTGATGTGGAATCTCGAGATTCCACATCACATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-1372s1c1
Sequence:CCGGCCTGCTTTCGATGTTAAGATTCTCGAGAATCTTAACATCGAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-357s1c1
Sequence:CCGGCCTGGACCAATGGACTGATAACTCGAGTTATCAGTCCATTGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-1632s21c1
Sequence:CCGGTATCCTCTGGCTATCGAATTGCTCGAGCAATTCGATAGCCAGAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-539s21c1
Sequence:CCGGCAAAGAGGAGATCGGGTAATTCTCGAGAATTACCCGATCTCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-1579s21c1
Sequence:CCGGTATGGATAAAGATGGGTATTTCTCGAGAAATACCCATCTTTATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-1319s21c1
Sequence:CCGGCAGACTGAAACGGTGCTAATCCTCGAGGATTAGCACCGTTTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005622
ACSM3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase medium-chain family member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-385s1c1
Sequence:CCGGGCTGGAAAGAAACCTTCAAATCTCGAGATTTGAAGGTTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-1747s1c1
Sequence:CCGGCCTGATTACAAGTCACATGATCTCGAGATCATGTGACTTGTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-967s1c1
Sequence:CCGGCCCTCAGATGTGATGTGGAATCTCGAGATTCCACATCACATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-1372s1c1
Sequence:CCGGCCTGCTTTCGATGTTAAGATTCTCGAGAATCTTAACATCGAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-357s1c1
Sequence:CCGGCCTGGACCAATGGACTGATAACTCGAGTTATCAGTCCATTGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-1632s21c1
Sequence:CCGGTATCCTCTGGCTATCGAATTGCTCGAGCAATTCGATAGCCAGAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-539s21c1
Sequence:CCGGCAAAGAGGAGATCGGGTAATTCTCGAGAATTACCCGATCTCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-1579s21c1
Sequence:CCGGTATGGATAAAGATGGGTATTTCTCGAGAAATACCCATCTTTATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-1319s21c1
Sequence:CCGGCAGACTGAAACGGTGCTAATCCTCGAGGATTAGCACCGTTTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005622
ACSM3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase medium-chain family member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-385s1c1
Sequence:CCGGGCTGGAAAGAAACCTTCAAATCTCGAGATTTGAAGGTTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-1747s1c1
Sequence:CCGGCCTGATTACAAGTCACATGATCTCGAGATCATGTGACTTGTAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-967s1c1
Sequence:CCGGCCCTCAGATGTGATGTGGAATCTCGAGATTCCACATCACATCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-1372s1c1
Sequence:CCGGCCTGCTTTCGATGTTAAGATTCTCGAGAATCTTAACATCGAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005622.2-357s1c1
Sequence:CCGGCCTGGACCAATGGACTGATAACTCGAGTTATCAGTCCATTGGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-1632s21c1
Sequence:CCGGTATCCTCTGGCTATCGAATTGCTCGAGCAATTCGATAGCCAGAGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-539s21c1
Sequence:CCGGCAAAGAGGAGATCGGGTAATTCTCGAGAATTACCCGATCTCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-1579s21c1
Sequence:CCGGTATGGATAAAGATGGGTATTTCTCGAGAAATACCCATCTTTATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005622.3-1319s21c1
Sequence:CCGGCAGACTGAAACGGTGCTAATCCTCGAGGATTAGCACCGTTTCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks