EMAIL THIS PAGE TO A FRIEND

ACSM4

acyl-CoA synthetase medium-chain family member 4

51 Gene Product Result for
UniProtKB ID: P0C7M7, A8MTI6
Gene ID:
Mouse(233801) acyl-CoA synthetase medium-chain family member 4
Rat(353317) acyl-CoA synthetase medium-chain family member 4
chicken(426991) acyl-CoA synthetase medium-chain family member 4
Horse(100068752) acyl-CoA synthetase medium-chain family member 4
dog(479821) acyl-coenzyme A synthetase ACSM4, mitochondrial-like
cow(100299006) acyl-CoA synthetase medium-chain family member 4
naked mole-rat(101698533) acyl-CoA synthetase medium-chain family member 4
domestic guinea pig(100735784) acyl-CoA synthetase medium-chain family member 4
sheep(101120794) acyl-CoA synthetase medium-chain family member 4
Domestic Rabbit(100350992) acyl-CoA synthetase medium-chain family member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080454 Rosetta Predictions human pricing
XM_292035 Rosetta Predictions human pricing
NM_181695 Rosetta Predictions rat pricing
NM_178414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314996 predicted 1464
2 SASI_Hs02_00314997 predicted 432
3 SASI_Hs02_00314998 predicted 649
4 SASI_Hs02_00314999 predicted 1250
5 SASI_Hs02_00315000 predicted 913
6 SASI_Hs02_00315001 predicted 765
7 SASI_Hs02_00315002 predicted 474
8 SASI_Hs02_00315003 predicted 1439
9 SASI_Hs02_00315004 predicted 1087
10 SASI_Hs02_00315005 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300783 predicted 357
2 SASI_Hs01_00300784 predicted 529
3 SASI_Hs01_00300785 predicted 429
4 SASI_Hs01_00300786 predicted 593
5 SASI_Hs01_00300787 predicted 654
6 SASI_Hs01_00300788 predicted 604
7 SASI_Hs01_00300789 predicted 659
8 SASI_Hs01_00300790 predicted 542
9 SASI_Hs01_00300791 predicted 546
10 SASI_Hs01_00300792 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119532 predicted 264
2 SASI_Rn01_00119533 predicted 1431
3 SASI_Rn01_00119534 predicted 1311
4 SASI_Rn01_00119535 predicted 1233
5 SASI_Rn01_00119536 predicted 250
6 SASI_Rn01_00119537 predicted 1107
7 SASI_Rn01_00119538 predicted 1531
8 SASI_Rn01_00119539 predicted 905
9 SASI_Rn02_00269788 predicted 776
10 SASI_Rn01_00119540 predicted 1025
11 SASI_Rn01_00119541 predicted 1771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180415 predicted 245
2 SASI_Mm02_00348869 predicted 235
3 SASI_Mm01_00180416 predicted 1541
4 SASI_Mm01_00180417 predicted 908
5 SASI_Mm01_00180418 predicted 271
6 SASI_Mm01_00180419 predicted 1595
7 SASI_Mm01_00180420 predicted 1117
8 SASI_Mm01_00180422 predicted 780
9 SASI_Mm01_00180423 predicted 531
10 SASI_Mm01_00180424 predicted 1047
11 SASI_Mm01_00180421 predicted 597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080454
ACSM4 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase medium-chain family member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-749s21c1
Sequence:CCGGTCACCCTCTGCGGAAGGTATTCTCGAGAATACCTTCCGCAGAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-916s21c1
Sequence:CCGGCTAGACACACTTACTACTTATCTCGAGATAAGTAGTAAGTGTGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-1506s21c1
Sequence:CCGGTGTCAGTAGTCCAGATCAAATCTCGAGATTTGATCTGGACTACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-779s21c1
Sequence:CCGGTGAAGTCCTCAGATATCATATCTCGAGATATGATATCTGAGGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-598s21c1
Sequence:CCGGCTCAGCTTCCAGGAGTTATTTCTCGAGAAATAACTCCTGGAAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080454
ACSM4 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase medium-chain family member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-749s21c1
Sequence:CCGGTCACCCTCTGCGGAAGGTATTCTCGAGAATACCTTCCGCAGAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-916s21c1
Sequence:CCGGCTAGACACACTTACTACTTATCTCGAGATAAGTAGTAAGTGTGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-1506s21c1
Sequence:CCGGTGTCAGTAGTCCAGATCAAATCTCGAGATTTGATCTGGACTACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-779s21c1
Sequence:CCGGTGAAGTCCTCAGATATCATATCTCGAGATATGATATCTGAGGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-598s21c1
Sequence:CCGGCTCAGCTTCCAGGAGTTATTTCTCGAGAAATAACTCCTGGAAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080454
ACSM4 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase medium-chain family member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-749s21c1
Sequence:CCGGTCACCCTCTGCGGAAGGTATTCTCGAGAATACCTTCCGCAGAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-916s21c1
Sequence:CCGGCTAGACACACTTACTACTTATCTCGAGATAAGTAGTAAGTGTGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-1506s21c1
Sequence:CCGGTGTCAGTAGTCCAGATCAAATCTCGAGATTTGATCTGGACTACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-779s21c1
Sequence:CCGGTGAAGTCCTCAGATATCATATCTCGAGATATGATATCTGAGGACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080454.1-598s21c1
Sequence:CCGGCTCAGCTTCCAGGAGTTATTTCTCGAGAAATAACTCCTGGAAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178414
ACSM4 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase medium-chain family member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178414.2-1884s1c1
Sequence:CCGGCTAGAAGTGATGCGGTTGGTTCTCGAGAACCAACCGCATCACTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-1268s1c1
Sequence:CCGGCGCAAAGGAGAAGCAATTAAACTCGAGTTTAATTGCTTCTCCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-508s1c1
Sequence:CCGGGCTCATCAATGTGGCTTGCATCTCGAGATGCAAGCCACATTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-1275s1c1
Sequence:CCGGGAGAAGCAATTAAACCAGGTTCTCGAGAACCTGGTTTAATTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-953s1c1
Sequence:CCGGGCTGCCATTGGTAGTGTGTTTCTCGAGAAACACACTACCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178414
ACSM4 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase medium-chain family member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178414.2-1884s1c1
Sequence:CCGGCTAGAAGTGATGCGGTTGGTTCTCGAGAACCAACCGCATCACTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-1268s1c1
Sequence:CCGGCGCAAAGGAGAAGCAATTAAACTCGAGTTTAATTGCTTCTCCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-508s1c1
Sequence:CCGGGCTCATCAATGTGGCTTGCATCTCGAGATGCAAGCCACATTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-1275s1c1
Sequence:CCGGGAGAAGCAATTAAACCAGGTTCTCGAGAACCTGGTTTAATTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-953s1c1
Sequence:CCGGGCTGCCATTGGTAGTGTGTTTCTCGAGAAACACACTACCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178414
ACSM4 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase medium-chain family member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178414.2-1884s1c1
Sequence:CCGGCTAGAAGTGATGCGGTTGGTTCTCGAGAACCAACCGCATCACTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-1268s1c1
Sequence:CCGGCGCAAAGGAGAAGCAATTAAACTCGAGTTTAATTGCTTCTCCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-508s1c1
Sequence:CCGGGCTCATCAATGTGGCTTGCATCTCGAGATGCAAGCCACATTGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-1275s1c1
Sequence:CCGGGAGAAGCAATTAAACCAGGTTCTCGAGAACCTGGTTTAATTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178414.2-953s1c1
Sequence:CCGGGCTGCCATTGGTAGTGTGTTTCTCGAGAAACACACTACCAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks