EMAIL THIS PAGE TO A FRIEND

ACSM5

acyl-CoA synthetase medium-chain family member 5

127 Gene Product Result for
UniProtKB ID: Q6NUN0, Q96AV1, Q96CX8, Q9NWV3
Gene ID:
Mouse(272428) acyl-CoA synthetase medium-chain family member 5
Rat(361637) acyl-CoA synthetase medium-chain family member 5
sheep(101112785) acyl-CoA synthetase medium-chain family member 5
Domestic Rabbit(100352493) acyl-CoA synthetase medium-chain family member 5
domestic guinea pig(100733357) acyl-CoA synthetase medium-chain family member 5
naked mole-rat(101711830) acyl-CoA synthetase medium-chain family member 5
chicken(426992) acyl-CoA synthetase medium-chain family member 5
cow(785935) acyl-CoA synthetase medium-chain family member 5
cow(100298888) acyl-CoA synthetase medium-chain family member 5
Horse(100147266) acyl-CoA synthetase medium-chain family member 5
domestic cat(101092980) acyl-CoA synthetase medium-chain family member 5
dog(609009) acyl-CoA synthetase medium-chain family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017888 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067951 MISSION® esiRNA esiRNA human ACSM5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017888 Rosetta Predictions human pricing
NM_001014162 Rosetta Predictions rat pricing
XM_001078997 Rosetta Predictions rat pricing
NM_178758 Rosetta Predictions mouse pricing
XM_001002982 Rosetta Predictions mouse pricing
XM_001002996 Rosetta Predictions mouse pricing
XM_001003001 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044784 predicted 1564
2 SASI_Hs01_00044785 predicted 1552
3 SASI_Hs01_00044786 predicted 1002
4 SASI_Hs01_00044787 predicted 1849
5 SASI_Hs01_00044788 predicted 1433
6 SASI_Hs01_00044789 predicted 1052
7 SASI_Hs01_00044790 predicted 938
8 SASI_Hs01_00044793 predicted 1271
9 SASI_Hs02_00350845 predicted 996
10 SASI_Hs02_00350846 predicted 564
11 SASI_Hs01_00044791 predicted 1140
12 SASI_Hs01_00044792 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039022 predicted 1934
2 SASI_Rn01_00039023 predicted 1811
3 SASI_Rn02_00201649 predicted 2073
4 SASI_Rn01_00039025 predicted 1987
5 SASI_Rn01_00039026 predicted 1664
6 SASI_Rn01_00039027 predicted 909
7 SASI_Rn01_00039028 predicted 1012
8 SASI_Rn01_00039031 predicted 1144
9 SASI_Rn02_00201650 predicted 739
10 SASI_Rn02_00201651 predicted 1936
11 SASI_Rn01_00039024 predicted 577
12 SASI_Rn01_00039029 predicted 689
13 SASI_Rn01_00039030 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362788 predicted 1946
2 SASI_Rn02_00362789 predicted 1820
3 SASI_Rn02_00362790 predicted 2088
4 SASI_Rn02_00362791 predicted 1540
5 SASI_Rn02_00362792 predicted 1995
6 SASI_Rn02_00362793 predicted 902
7 SASI_Rn02_00362794 predicted 1007
8 SASI_Rn02_00362795 predicted 1431
9 SASI_Rn02_00362796 predicted 1146
10 SASI_Rn02_00362797 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349302 predicted 1876
2 SASI_Mm02_00349303 predicted 1748
3 SASI_Mm02_00349304 predicted 1600
4 SASI_Mm02_00349305 predicted 1188
5 SASI_Mm02_00349306 predicted 782
6 SASI_Mm02_00349307 predicted 572
7 SASI_Mm02_00349308 predicted 1370
8 SASI_Mm02_00349309 predicted 1311
9 SASI_Mm02_00349310 predicted 1435
10 SASI_Mm02_00349311 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252771 predicted 1941
2 SASI_Mm01_00252772 predicted 1813
3 SASI_Mm01_00252773 predicted 984
4 SASI_Mm01_00252774 predicted 1954
5 SASI_Mm01_00252775 predicted 978
6 SASI_Mm01_00252776 predicted 1671
7 SASI_Mm01_00252777 predicted 1245
8 SASI_Mm01_00252778 predicted 987
9 SASI_Mm01_00252779 predicted 1433
10 SASI_Mm01_00252780 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283694 predicted 676
2 SASI_Mm01_00283695 predicted 510
3 SASI_Mm01_00283696 predicted 677
4 SASI_Mm01_00283697 predicted 591
5 SASI_Mm01_00283698 predicted 533
6 SASI_Mm01_00283699 predicted 737
7 SASI_Mm01_00283700 predicted 539
8 SASI_Mm01_00283701 predicted 642
9 SASI_Mm01_00283702 predicted 680
10 SASI_Mm01_00283703 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246180 predicted 758
2 SASI_Mm01_00246181 predicted 436
3 SASI_Mm01_00246182 predicted 596
4 SASI_Mm01_00246183 predicted 469
5 SASI_Mm01_00246184 predicted 661
6 SASI_Mm01_00246185 predicted 314
7 SASI_Mm01_00246186 predicted 373
8 SASI_Mm01_00246187 predicted 570
9 SASI_Mm01_00246188 predicted 607
10 SASI_Mm01_00246189 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178758
ACSM5 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase medium-chain family member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178758.2-2293s1c1
Sequence:CCGGCCTTCCATTTAGACACACTTTCTCGAGAAAGTGTGTCTAAATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-1852s1c1
Sequence:CCGGCCTAAGGAGTAAATTGAGAAACTCGAGTTTCTCAATTTACTCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-1340s1c1
Sequence:CCGGCCACCTTACGATGTGCAGATTCTCGAGAATCTGCACATCGTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-1162s1c1
Sequence:CCGGCCAATGTCTGAGGCACTGTTTCTCGAGAAACAGTGCCTCAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-929s1c1
Sequence:CCGGGCCTTGACTGAGTCTGACATACTCGAGTATGTCAGACTCAGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178758
ACSM5 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase medium-chain family member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178758.2-2293s1c1
Sequence:CCGGCCTTCCATTTAGACACACTTTCTCGAGAAAGTGTGTCTAAATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-1852s1c1
Sequence:CCGGCCTAAGGAGTAAATTGAGAAACTCGAGTTTCTCAATTTACTCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-1340s1c1
Sequence:CCGGCCACCTTACGATGTGCAGATTCTCGAGAATCTGCACATCGTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-1162s1c1
Sequence:CCGGCCAATGTCTGAGGCACTGTTTCTCGAGAAACAGTGCCTCAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-929s1c1
Sequence:CCGGGCCTTGACTGAGTCTGACATACTCGAGTATGTCAGACTCAGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178758
ACSM5 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase medium-chain family member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178758.2-2293s1c1
Sequence:CCGGCCTTCCATTTAGACACACTTTCTCGAGAAAGTGTGTCTAAATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-1852s1c1
Sequence:CCGGCCTAAGGAGTAAATTGAGAAACTCGAGTTTCTCAATTTACTCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-1340s1c1
Sequence:CCGGCCACCTTACGATGTGCAGATTCTCGAGAATCTGCACATCGTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-1162s1c1
Sequence:CCGGCCAATGTCTGAGGCACTGTTTCTCGAGAAACAGTGCCTCAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178758.2-929s1c1
Sequence:CCGGGCCTTGACTGAGTCTGACATACTCGAGTATGTCAGACTCAGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017888
ACSM5 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase medium-chain family member 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017888.2-2240s1c1
Sequence:CCGGCCAGTGGGAATGTAAAGGCTTCTCGAGAAGCCTTTACATTCCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-1824s1c1
Sequence:CCGGGCCAAAGACGGTTTCTGGAAACTCGAGTTTCCAGAAACCGTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017888.2-1967s1c1
Sequence:CCGGGCATCATCTCTTCGACCCTAACTCGAGTTAGGGTCGAAGAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-594s1c1
Sequence:CCGGGACAGAGAAGGACCTCAAGTACTCGAGTACTTGAGGTCCTTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017888.2-1260s1c1
Sequence:CCGGCCAGTCTGAAACGGTTGTCATCTCGAGATGACAACCGTTTCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-1679s1c1
Sequence:CCGGGAGAGGTGGTAAAGGCATTTACTCGAGTAAATGCCTTTACCACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-1345s1c1
Sequence:CCGGGATGTGCAGATTGTGGATGATCTCGAGATCATCCACAATCTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017888.2-2172s1c1
Sequence:CCGGGCTTTCAGATTTCCCTCCATACTCGAGTATGGAGGGAAATCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017888.2-1572s1c1
Sequence:CCGGCAATTCTTCAAGCTACCGGATCTCGAGATCCGGTAGCTTGAAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017888
ACSM5 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase medium-chain family member 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017888.2-2240s1c1
Sequence:CCGGCCAGTGGGAATGTAAAGGCTTCTCGAGAAGCCTTTACATTCCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-1824s1c1
Sequence:CCGGGCCAAAGACGGTTTCTGGAAACTCGAGTTTCCAGAAACCGTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017888.2-1967s1c1
Sequence:CCGGGCATCATCTCTTCGACCCTAACTCGAGTTAGGGTCGAAGAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-594s1c1
Sequence:CCGGGACAGAGAAGGACCTCAAGTACTCGAGTACTTGAGGTCCTTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017888.2-1260s1c1
Sequence:CCGGCCAGTCTGAAACGGTTGTCATCTCGAGATGACAACCGTTTCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-1679s1c1
Sequence:CCGGGAGAGGTGGTAAAGGCATTTACTCGAGTAAATGCCTTTACCACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-1345s1c1
Sequence:CCGGGATGTGCAGATTGTGGATGATCTCGAGATCATCCACAATCTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017888.2-2172s1c1
Sequence:CCGGGCTTTCAGATTTCCCTCCATACTCGAGTATGGAGGGAAATCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017888.2-1572s1c1
Sequence:CCGGCAATTCTTCAAGCTACCGGATCTCGAGATCCGGTAGCTTGAAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017888
ACSM5 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase medium-chain family member 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158310    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017888.2-2240s1c1
Sequence:CCGGCCAGTGGGAATGTAAAGGCTTCTCGAGAAGCCTTTACATTCCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-1824s1c1
Sequence:CCGGGCCAAAGACGGTTTCTGGAAACTCGAGTTTCCAGAAACCGTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017888.2-1967s1c1
Sequence:CCGGGCATCATCTCTTCGACCCTAACTCGAGTTAGGGTCGAAGAGATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-594s1c1
Sequence:CCGGGACAGAGAAGGACCTCAAGTACTCGAGTACTTGAGGTCCTTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017888.2-1260s1c1
Sequence:CCGGCCAGTCTGAAACGGTTGTCATCTCGAGATGACAACCGTTTCAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-1679s1c1
Sequence:CCGGGAGAGGTGGTAAAGGCATTTACTCGAGTAAATGCCTTTACCACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017888.2-1345s1c1
Sequence:CCGGGATGTGCAGATTGTGGATGATCTCGAGATCATCCACAATCTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017888.2-2172s1c1
Sequence:CCGGGCTTTCAGATTTCCCTCCATACTCGAGTATGGAGGGAAATCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017888.2-1572s1c1
Sequence:CCGGCAATTCTTCAAGCTACCGGATCTCGAGATCCGGTAGCTTGAAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks