EMAIL THIS PAGE TO A FRIEND

ACSS1

acyl-CoA synthetase short-chain family member 1

47 Gene Product Result for
Synonyms: ACAS2L ACECS1 AceCS2L
Gene ID:
Human(84532) Summary: This gene encodes a mitochondrial acetyl-CoA synthetase enzyme. A similar protein in mice plays an important role in the tricarboxylic acid cycle by catalyzing the conversion of acetate to acetyl CoA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(68738) acyl-CoA synthetase short-chain family member 1
Rat(296259) acyl-CoA synthetase short-chain family member 1
naked mole-rat(101718141) acyl-CoA synthetase short-chain family member 1
domestic guinea pig(100721003) acyl-CoA synthetase short-chain family member 1
Zebrafish(541435) acyl-CoA synthetase short-chain family member 1
cow(282873) acyl-CoA synthetase short-chain family member 1
Horse(100057725) acyl-CoA synthetase short-chain family member 1
domestic cat(101089092) acyl-CoA synthetase short-chain family member 1
dog(477002) acyl-CoA synthetase short-chain family member 1
chicken(416714) acyl-CoA synthetase short-chain family member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032501 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040311 MISSION® esiRNA esiRNA human ACSS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032501 Rosetta Predictions human pricing
NM_001106524 Rosetta Predictions rat pricing
NM_080575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220390 predicted 2737
2 SASI_Hs01_00220391 predicted 2256
3 SASI_Hs01_00220392 predicted 2891
4 SASI_Hs01_00220393 predicted 1822
5 SASI_Hs01_00220394 predicted 2745
6 SASI_Hs01_00220395 predicted 1203
7 SASI_Hs01_00220396 predicted 1196
8 SASI_Hs01_00220397 predicted 2482
9 SASI_Hs01_00220398 predicted 2451
10 SASI_Hs02_00359980 predicted 1999
11 SASI_Hs01_00220399 predicted 2745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219808 predicted 2143
2 SASI_Rn02_00219809 predicted 866
3 SASI_Rn02_00219810 predicted 1492
4 SASI_Rn02_00219811 predicted 1392
5 SASI_Rn02_00219812 predicted 1693
6 SASI_Rn02_00219813 predicted 394
7 SASI_Rn02_00219814 predicted 861
8 SASI_Rn02_00219815 predicted 2010
9 SASI_Rn02_00219816 predicted 843
10 SASI_Rn02_00219817 predicted 1812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034988 predicted 1775
2 SASI_Mm01_00034989 predicted 1778
3 SASI_Mm01_00034990 predicted 652
4 SASI_Mm01_00034991 predicted 465
5 SASI_Mm01_00034992 predicted 583
6 SASI_Mm01_00034993 predicted 1395
7 SASI_Mm01_00034994 predicted 862
8 SASI_Mm01_00034995 predicted 1817
9 SASI_Mm01_00034996 predicted 1746
10 SASI_Mm01_00034997 predicted 1871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080575
ACSS1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase short-chain family member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080575.1-2919s1c1
Sequence:CCGGGCCTCATAGTAGGAGATCATACTCGAGTATGATCTCCTACTATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-1654s1c1
Sequence:CCGGGCATGGATGATGTCATCAATACTCGAGTATTGATGACATCATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-1497s1c1
Sequence:CCGGGCCTTGTGTATTTCCCAAGCTCTCGAGAGCTTGGGAAATACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-1145s1c1
Sequence:CCGGGCTAAAGATCAACCAGTTCTACTCGAGTAGAACTGGTTGATCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-471s1c1
Sequence:CCGGGCCAATACACTGAAGAGACATCTCGAGATGTCTCTTCAGTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080575
ACSS1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase short-chain family member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080575.1-2919s1c1
Sequence:CCGGGCCTCATAGTAGGAGATCATACTCGAGTATGATCTCCTACTATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-1654s1c1
Sequence:CCGGGCATGGATGATGTCATCAATACTCGAGTATTGATGACATCATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-1497s1c1
Sequence:CCGGGCCTTGTGTATTTCCCAAGCTCTCGAGAGCTTGGGAAATACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-1145s1c1
Sequence:CCGGGCTAAAGATCAACCAGTTCTACTCGAGTAGAACTGGTTGATCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-471s1c1
Sequence:CCGGGCCAATACACTGAAGAGACATCTCGAGATGTCTCTTCAGTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080575
ACSS1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase short-chain family member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080575.1-2919s1c1
Sequence:CCGGGCCTCATAGTAGGAGATCATACTCGAGTATGATCTCCTACTATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-1654s1c1
Sequence:CCGGGCATGGATGATGTCATCAATACTCGAGTATTGATGACATCATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-1497s1c1
Sequence:CCGGGCCTTGTGTATTTCCCAAGCTCTCGAGAGCTTGGGAAATACACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-1145s1c1
Sequence:CCGGGCTAAAGATCAACCAGTTCTACTCGAGTAGAACTGGTTGATCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080575.1-471s1c1
Sequence:CCGGGCCAATACACTGAAGAGACATCTCGAGATGTCTCTTCAGTGTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032501
VALIDATED
ACSS1 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase short-chain family member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032501.2-2727s1c1
Sequence:CCGGGCCACCAAGATCGCCAAATATCTCGAGATATTTGGCGATCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_032501.2-1517s1c1
Sequence:CCGGCAAGGTGGTTATCACCTTCAACTCGAGTTGAAGGTGATAACCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032501.2-2909s1c1
Sequence:CCGGCTACCAGAAGTGCAAGGACAACTCGAGTTGTCCTTGCACTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_032501.2-2055s1c1
Sequence:CCGGCTGTTGCTGAAATACGGTGATCTCGAGATCACCGTATTTCAGCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032501.2-1196s1c1
Sequence:CCGGCCAGTTAAATGTCTCTGTCAACTCGAGTTGACAGAGACATTTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-1903s21c1
Sequence:CCGGGACACAGCTACGTGGTGTATGCTCGAGCATACACCACGTAGCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032501.2-3407s21c1
Sequence:CCGGACATGTAGTGTGTGGATTTACCTCGAGGTAAATCCACACACTACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-2447s21c1
Sequence:CCGGGGCCTACCCAGGCTATTACTTCTCGAGAAGTAATAGCCTGGGTAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-2011s21c1
Sequence:CCGGGGTTGAAGATCAATCAGTTCTCTCGAGAGAACTGATTGATCTTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-1299s21c1
Sequence:CCGGATCACCTACAGGGAACTACTGCTCGAGCAGTAGTTCCCTGTAGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032501
VALIDATED
ACSS1 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase short-chain family member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032501.2-2727s1c1
Sequence:CCGGGCCACCAAGATCGCCAAATATCTCGAGATATTTGGCGATCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_032501.2-1517s1c1
Sequence:CCGGCAAGGTGGTTATCACCTTCAACTCGAGTTGAAGGTGATAACCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032501.2-2909s1c1
Sequence:CCGGCTACCAGAAGTGCAAGGACAACTCGAGTTGTCCTTGCACTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_032501.2-2055s1c1
Sequence:CCGGCTGTTGCTGAAATACGGTGATCTCGAGATCACCGTATTTCAGCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032501.2-1196s1c1
Sequence:CCGGCCAGTTAAATGTCTCTGTCAACTCGAGTTGACAGAGACATTTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-1903s21c1
Sequence:CCGGGACACAGCTACGTGGTGTATGCTCGAGCATACACCACGTAGCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032501.2-3407s21c1
Sequence:CCGGACATGTAGTGTGTGGATTTACCTCGAGGTAAATCCACACACTACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-2447s21c1
Sequence:CCGGGGCCTACCCAGGCTATTACTTCTCGAGAAGTAATAGCCTGGGTAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-2011s21c1
Sequence:CCGGGGTTGAAGATCAATCAGTTCTCTCGAGAGAACTGATTGATCTTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-1299s21c1
Sequence:CCGGATCACCTACAGGGAACTACTGCTCGAGCAGTAGTTCCCTGTAGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032501
VALIDATED
ACSS1 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase short-chain family member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032501.2-2727s1c1
Sequence:CCGGGCCACCAAGATCGCCAAATATCTCGAGATATTTGGCGATCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_032501.2-1517s1c1
Sequence:CCGGCAAGGTGGTTATCACCTTCAACTCGAGTTGAAGGTGATAACCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032501.2-2909s1c1
Sequence:CCGGCTACCAGAAGTGCAAGGACAACTCGAGTTGTCCTTGCACTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_032501.2-2055s1c1
Sequence:CCGGCTGTTGCTGAAATACGGTGATCTCGAGATCACCGTATTTCAGCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032501.2-1196s1c1
Sequence:CCGGCCAGTTAAATGTCTCTGTCAACTCGAGTTGACAGAGACATTTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-1903s21c1
Sequence:CCGGGACACAGCTACGTGGTGTATGCTCGAGCATACACCACGTAGCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032501.2-3407s21c1
Sequence:CCGGACATGTAGTGTGTGGATTTACCTCGAGGTAAATCCACACACTACATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-2447s21c1
Sequence:CCGGGGCCTACCCAGGCTATTACTTCTCGAGAAGTAATAGCCTGGGTAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-2011s21c1
Sequence:CCGGGGTTGAAGATCAATCAGTTCTCTCGAGAGAACTGATTGATCTTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032501.2-1299s21c1
Sequence:CCGGATCACCTACAGGGAACTACTGCTCGAGCAGTAGTTCCCTGTAGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks