EMAIL THIS PAGE TO A FRIEND

ACSS2

acyl-CoA synthetase short-chain family member 2

148 Gene Product Result for
Synonyms: ACAS2 ACECS ACS ACSA dJ1161H23.1
Gene ID:
Human(55902) Summary: This gene encodes a cytosolic enzyme that catalyzes the activation of acetate for use in lipid synthesis and energy generation. The protein acts as a monomer and produces acetyl-CoA from acetate in a reaction that requires ATP. Expression of this gene is regulated by sterol regulatory element-binding proteins, transcription factors that activate genes required for the synthesis of cholesterol and unsaturated fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Mouse(60525) acyl-CoA synthetase short-chain family member 2
Rat(311569) acyl-CoA synthetase short-chain family member 2
Zebrafish(436914) acyl-CoA synthetase short-chain family member 2
dog(477205) acyl-CoA synthetase short-chain family member 2
cow(506459) acyl-CoA synthetase short-chain family member 2
Horse(100054562) acyl-CoA synthetase short-chain family member 2
domestic cat(101083834) acyl-CoA synthetase short-chain family member 2
chicken(419158) acyl-CoA synthetase short-chain family member 2
domestic guinea pig(100733496) acyl-CoA synthetase short-chain family member 2
naked mole-rat(101703127) acyl-CoA synthetase short-chain family member 2
sheep(780456) acyl-CoA synthetase short-chain family member 2
Domestic Rabbit(100346003) acyl-CoA synthetase short-chain family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018677 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135341 MISSION® esiRNA esiRNA human ACSS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076552 Rosetta Predictions human pricing
NM_018677 Rosetta Predictions human pricing
NM_139274 Rosetta Predictions human pricing
NM_001107793 Rosetta Predictions rat pricing
NM_019811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311926 predicted 1628
2 SASI_Hs02_00311927 predicted 575
3 SASI_Hs02_00311928 predicted 1024
4 SASI_Hs02_00311929 predicted 1699
5 SASI_Hs02_00311930 predicted 403
6 SASI_Hs02_00311931 predicted 1024
7 SASI_Hs02_00311932 predicted 1948
8 SASI_Hs02_00311933 predicted 1585
9 SASI_Hs02_00311934 predicted 855
10 SASI_Hs02_00311935 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043790 predicted 1698
2 SASI_Hs01_00043791 predicted 639
3 SASI_Hs01_00043792 predicted 1099
4 SASI_Hs01_00043793 predicted 1771
5 SASI_Hs01_00043794 predicted 478
6 SASI_Hs01_00043795 predicted 1089
7 SASI_Hs01_00043796 predicted 2018
8 SASI_Hs01_00043797 predicted 1647
9 SASI_Hs01_00043798 predicted 923
10 SASI_Hs01_00043799 predicted 1643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030119 predicted 1549
2 SASI_Hs01_00030120 predicted 488
3 SASI_Hs01_00030121 predicted 945
4 SASI_Hs01_00030122 predicted 1627
5 SASI_Hs01_00030123 predicted 330
6 SASI_Hs01_00030124 predicted 940
7 SASI_Hs01_00030125 predicted 1873
8 SASI_Hs01_00030126 predicted 1501
9 SASI_Hs01_00030127 predicted 775
10 SASI_Hs01_00030128 predicted 1495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232325 predicted 1507
2 SASI_Rn02_00232326 predicted 1418
3 SASI_Rn02_00232327 predicted 1064
4 SASI_Rn02_00232328 predicted 387
5 SASI_Rn02_00232329 predicted 297
6 SASI_Rn02_00232330 predicted 2064
7 SASI_Rn02_00232331 predicted 960
8 SASI_Rn02_00232332 predicted 503
9 SASI_Rn02_00232333 predicted 2256
10 SASI_Rn02_00232334 predicted 1808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021885 predicted 2253
2 SASI_Mm01_00021886 predicted 1178
3 SASI_Mm01_00021887 predicted 1064
4 SASI_Mm01_00021888 predicted 1507
5 SASI_Mm01_00021889 predicted 512
6 SASI_Mm01_00021890 predicted 1685
7 SASI_Mm01_00021891 predicted 306
8 SASI_Mm01_00021892 predicted 1040
9 SASI_Mm01_00021893 predicted 379
10 SASI_Mm02_00325083 predicted 1111
11 SASI_Mm01_00021884 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018677
ACSS2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase short-chain family member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000045563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018677.2-2629s1c1
Sequence:CCGGGCTTCTGTTCTGGGTCTGAATCTCGAGATTCAGACCCAGAACAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018677.2-1532s1c1
Sequence:CCGGCGGTTCTGCTACTTTCCCATTCTCGAGAATGGGAAAGTAGCAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018677.2-385s1c1
Sequence:CCGGGCTACAATGTACTGGATCGAACTCGAGTTCGATCCAGTACATTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018677.2-1673s1c1
Sequence:CCGGCGAACGCTTTGAGACAACCTACTCGAGTAGGTTGTCTCAAAGCGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018677
ACSS2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase short-chain family member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000045563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018677.2-2629s1c1
Sequence:CCGGGCTTCTGTTCTGGGTCTGAATCTCGAGATTCAGACCCAGAACAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018677.2-1532s1c1
Sequence:CCGGCGGTTCTGCTACTTTCCCATTCTCGAGAATGGGAAAGTAGCAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018677.2-385s1c1
Sequence:CCGGGCTACAATGTACTGGATCGAACTCGAGTTCGATCCAGTACATTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018677.2-1673s1c1
Sequence:CCGGCGAACGCTTTGAGACAACCTACTCGAGTAGGTTGTCTCAAAGCGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018677
ACSS2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase short-chain family member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000045563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018677.2-2629s1c1
Sequence:CCGGGCTTCTGTTCTGGGTCTGAATCTCGAGATTCAGACCCAGAACAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018677.2-1532s1c1
Sequence:CCGGCGGTTCTGCTACTTTCCCATTCTCGAGAATGGGAAAGTAGCAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018677.2-385s1c1
Sequence:CCGGGCTACAATGTACTGGATCGAACTCGAGTTCGATCCAGTACATTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018677.2-1673s1c1
Sequence:CCGGCGAACGCTTTGAGACAACCTACTCGAGTAGGTTGTCTCAAAGCGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019811
VALIDATED
ACSS2 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase short-chain family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019811.2-2397s1c1
Sequence:CCGGCCTTAACCAAAGTCAGCTCTTCTCGAGAAGAGCTGACTTTGGTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019811.2-1512s1c1
Sequence:CCGGCCATGAAACCTGGTTCTGCTTCTCGAGAAGCAGAACCAGGTTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019811.2-497s1c1
Sequence:CCGGGTGTGTCAGTTCAGCAATGTTCTCGAGAACATTGCTGAACTGACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019811.2-1667s1c1
Sequence:CCGGCGGTTTGAGACCACCTACTTTCTCGAGAAAGTAGGTGGTCTCAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019811.2-389s1c1
Sequence:CCGGGATCGAAATGTCCATGAGAAACTCGAGTTTCTCATGGACATTTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019811
VALIDATED
ACSS2 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase short-chain family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019811.2-2397s1c1
Sequence:CCGGCCTTAACCAAAGTCAGCTCTTCTCGAGAAGAGCTGACTTTGGTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019811.2-1512s1c1
Sequence:CCGGCCATGAAACCTGGTTCTGCTTCTCGAGAAGCAGAACCAGGTTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019811.2-497s1c1
Sequence:CCGGGTGTGTCAGTTCAGCAATGTTCTCGAGAACATTGCTGAACTGACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019811.2-1667s1c1
Sequence:CCGGCGGTTTGAGACCACCTACTTTCTCGAGAAAGTAGGTGGTCTCAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019811.2-389s1c1
Sequence:CCGGGATCGAAATGTCCATGAGAAACTCGAGTTTCTCATGGACATTTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019811
VALIDATED
ACSS2 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase short-chain family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019811.2-2397s1c1
Sequence:CCGGCCTTAACCAAAGTCAGCTCTTCTCGAGAAGAGCTGACTTTGGTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019811.2-1512s1c1
Sequence:CCGGCCATGAAACCTGGTTCTGCTTCTCGAGAAGCAGAACCAGGTTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019811.2-497s1c1
Sequence:CCGGGTGTGTCAGTTCAGCAATGTTCTCGAGAACATTGCTGAACTGACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019811.2-1667s1c1
Sequence:CCGGCGGTTTGAGACCACCTACTTTCTCGAGAAAGTAGGTGGTCTCAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019811.2-389s1c1
Sequence:CCGGGATCGAAATGTCCATGAGAAACTCGAGTTTCTCATGGACATTTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)