EMAIL THIS PAGE TO A FRIEND

ACSS3

acyl-CoA synthetase short-chain family member 3

54 Gene Product Result for
UniProtKB ID: Q9H6R3, Q8NC66
Gene ID:
Mouse(380660) acyl-CoA synthetase short-chain family member 3
Rat(314800) acyl-CoA synthetase short-chain family member 3
sheep(101103801) acyl-CoA synthetase short-chain family member 3
naked mole-rat(101718668) acyl-CoA synthetase short-chain family member 3
domestic guinea pig(100733908) acyl-CoA synthetase short-chain family member 3
Zebrafish(566019) acyl-CoA synthetase short-chain family member 3
cow(531552) acyl-CoA synthetase short-chain family member 3
Horse(100061000) acyl-CoA synthetase short-chain family member 3
dog(475414) acyl-CoA synthetase short-chain family member 3
chicken(417875) acyl-CoA synthetase short-chain family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024560 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024560 Rosetta Predictions human pricing
NM_001108091 Rosetta Predictions rat pricing
NM_198636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356868 predicted 395
2 SASI_Hs01_00172133 predicted 996
3 SASI_Hs01_00172135 predicted 593
4 SASI_Hs01_00172137 predicted 1218
5 SASI_Hs01_00172138 predicted 1524
6 SASI_Hs01_00172139 predicted 739
7 SASI_Hs01_00172140 predicted 784
8 SASI_Hs01_00172141 predicted 1269
9 SASI_Hs01_00172142 predicted 792
10 SASI_Hs02_00356869 predicted 1795
11 SASI_Hs01_00172134 predicted 2079
12 SASI_Hs01_00172136 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235264 predicted 969
2 SASI_Rn02_00235265 predicted 595
3 SASI_Rn02_00235266 predicted 1144
4 SASI_Rn02_00235267 predicted 686
5 SASI_Rn02_00235268 predicted 405
6 SASI_Rn02_00235269 predicted 723
7 SASI_Rn02_00235270 predicted 1106
8 SASI_Rn02_00235271 predicted 856
9 SASI_Rn02_00235272 predicted 466
10 SASI_Rn02_00235273 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119903 predicted 1100
2 SASI_Mm01_00119904 predicted 1138
3 SASI_Mm01_00119905 predicted 1447
4 SASI_Mm01_00119906 predicted 567
5 SASI_Mm01_00119907 predicted 962
6 SASI_Mm01_00119908 predicted 1191
7 SASI_Mm01_00119909 predicted 590
8 SASI_Mm01_00119910 predicted 846
9 SASI_Mm01_00119911 predicted 695
10 SASI_Mm01_00119912 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024560
VALIDATED
ACSS3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase short-chain family member 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024560.2-2305s1c1
Sequence:CCGGCATGTGAAAGACCTGTGCCTTCTCGAGAAGGCACAGGTCTTTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024560.2-1800s1c1
Sequence:CCGGCCATTGAAGAGTCAATCCTTTCTCGAGAAAGGATTGACTCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024560.2-2438s1c1
Sequence:CCGGCCTCCCAAGAAGAACACTTTACTCGAGTAAAGTGTTCTTCTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024560.2-2002s1c1
Sequence:CCGGGTTTGTCAAACAGCTACCCAACTCGAGTTGGGTAGCTGTTTGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024560.2-1799s1c1
Sequence:CCGGGCCATTGAAGAGTCAATCCTTCTCGAGAAGGATTGACTCTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024560.2-1577s1c1
Sequence:CCGGGCTCGGTGTTTAGGAAATATTCTCGAGAATATTTCCTAAACACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024560.2-1991s1c1
Sequence:CCGGCGAAATGCAGTGTTTGTCAAACTCGAGTTTGACAAACACTGCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024560.2-2483s1c1
Sequence:CCGGCCACTTCCTGAAACCAAGAATCTCGAGATTCTTGGTTTCAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024560.2-1361s1c1
Sequence:CCGGGCTGGAGAACGATGTGATGTACTCGAGTACATCACATCGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024560.2-2483s21c1
Sequence:CCGGCCACTTCCTGAAACCAAGAATCTCGAGATTCTTGGTTTCAGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024560.2-1577s21c1
Sequence:CCGGGCTCGGTGTTTAGGAAATATTCTCGAGAATATTTCCTAAACACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024560.2-1361s21c1
Sequence:CCGGGCTGGAGAACGATGTGATGTACTCGAGTACATCACATCGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024560.2-2438s21c1
Sequence:CCGGCCTCCCAAGAAGAACACTTTACTCGAGTAAAGTGTTCTTCTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024560
VALIDATED
ACSS3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase short-chain family member 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024560.2-2305s1c1
Sequence:CCGGCATGTGAAAGACCTGTGCCTTCTCGAGAAGGCACAGGTCTTTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024560.2-1800s1c1
Sequence:CCGGCCATTGAAGAGTCAATCCTTTCTCGAGAAAGGATTGACTCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024560.2-2438s1c1
Sequence:CCGGCCTCCCAAGAAGAACACTTTACTCGAGTAAAGTGTTCTTCTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024560.2-2002s1c1
Sequence:CCGGGTTTGTCAAACAGCTACCCAACTCGAGTTGGGTAGCTGTTTGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024560.2-1799s1c1
Sequence:CCGGGCCATTGAAGAGTCAATCCTTCTCGAGAAGGATTGACTCTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024560.2-1577s1c1
Sequence:CCGGGCTCGGTGTTTAGGAAATATTCTCGAGAATATTTCCTAAACACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024560.2-1991s1c1
Sequence:CCGGCGAAATGCAGTGTTTGTCAAACTCGAGTTTGACAAACACTGCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024560.2-2483s1c1
Sequence:CCGGCCACTTCCTGAAACCAAGAATCTCGAGATTCTTGGTTTCAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024560.2-1361s1c1
Sequence:CCGGGCTGGAGAACGATGTGATGTACTCGAGTACATCACATCGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024560.2-2483s21c1
Sequence:CCGGCCACTTCCTGAAACCAAGAATCTCGAGATTCTTGGTTTCAGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024560.2-1577s21c1
Sequence:CCGGGCTCGGTGTTTAGGAAATATTCTCGAGAATATTTCCTAAACACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024560.2-1361s21c1
Sequence:CCGGGCTGGAGAACGATGTGATGTACTCGAGTACATCACATCGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024560.2-2438s21c1
Sequence:CCGGCCTCCCAAGAAGAACACTTTACTCGAGTAAAGTGTTCTTCTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024560
VALIDATED
ACSS3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase short-chain family member 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024560.2-2305s1c1
Sequence:CCGGCATGTGAAAGACCTGTGCCTTCTCGAGAAGGCACAGGTCTTTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024560.2-1800s1c1
Sequence:CCGGCCATTGAAGAGTCAATCCTTTCTCGAGAAAGGATTGACTCTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153547    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024560.2-2438s1c1
Sequence:CCGGCCTCCCAAGAAGAACACTTTACTCGAGTAAAGTGTTCTTCTTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024560.2-2002s1c1
Sequence:CCGGGTTTGTCAAACAGCTACCCAACTCGAGTTGGGTAGCTGTTTGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024560.2-1799s1c1
Sequence:CCGGGCCATTGAAGAGTCAATCCTTCTCGAGAAGGATTGACTCTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024560.2-1577s1c1
Sequence:CCGGGCTCGGTGTTTAGGAAATATTCTCGAGAATATTTCCTAAACACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024560.2-1991s1c1
Sequence:CCGGCGAAATGCAGTGTTTGTCAAACTCGAGTTTGACAAACACTGCATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024560.2-2483s1c1
Sequence:CCGGCCACTTCCTGAAACCAAGAATCTCGAGATTCTTGGTTTCAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024560.2-1361s1c1
Sequence:CCGGGCTGGAGAACGATGTGATGTACTCGAGTACATCACATCGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024560.2-2483s21c1
Sequence:CCGGCCACTTCCTGAAACCAAGAATCTCGAGATTCTTGGTTTCAGGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024560.2-1577s21c1
Sequence:CCGGGCTCGGTGTTTAGGAAATATTCTCGAGAATATTTCCTAAACACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024560.2-1361s21c1
Sequence:CCGGGCTGGAGAACGATGTGATGTACTCGAGTACATCACATCGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024560.2-2438s21c1
Sequence:CCGGCCTCCCAAGAAGAACACTTTACTCGAGTAAAGTGTTCTTCTTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198636
ACSS3 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA synthetase short-chain family member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198636.1-1703s1c1
Sequence:CCGGCCCTAGTATATGTGTTCCATTCTCGAGAATGGAACACATATACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-944s1c1
Sequence:CCGGGCATCCATTGTACATTCTCTACTCGAGTAGAGAATGTACAATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-1362s1c1
Sequence:CCGGGAGACCCTAGAATGGTCCAAACTCGAGTTTGGACCATTCTAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-368s1c1
Sequence:CCGGGCCTTCCACAAGTTGGTTTGTCTCGAGACAAACCAACTTGTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-712s1c1
Sequence:CCGGCGAAGCCTAAGGTGGTTGTTACTCGAGTAACAACCACCTTAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-1100s21c1
Sequence:CCGGTTGTTGGACATTCCTATATTTCTCGAGAAATATAGGAATGTCCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-643s21c1
Sequence:CCGGGCAATCCACAGTCTCATATTTCTCGAGAAATATGAGACTGTGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-410s21c1
Sequence:CCGGATGCTATTGATCGGCACATTGCTCGAGCAATGTGCCGATCAATAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-569s21c1
Sequence:CCGGGCGATACAGTGGTCATCTATACTCGAGTATAGATGACCACTGTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198636
ACSS3 MISSION shRNA shRNA Plasmid DNA
acyl-CoA synthetase short-chain family member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198636.1-1703s1c1
Sequence:CCGGCCCTAGTATATGTGTTCCATTCTCGAGAATGGAACACATATACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-944s1c1
Sequence:CCGGGCATCCATTGTACATTCTCTACTCGAGTAGAGAATGTACAATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-1362s1c1
Sequence:CCGGGAGACCCTAGAATGGTCCAAACTCGAGTTTGGACCATTCTAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-368s1c1
Sequence:CCGGGCCTTCCACAAGTTGGTTTGTCTCGAGACAAACCAACTTGTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-712s1c1
Sequence:CCGGCGAAGCCTAAGGTGGTTGTTACTCGAGTAACAACCACCTTAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-1100s21c1
Sequence:CCGGTTGTTGGACATTCCTATATTTCTCGAGAAATATAGGAATGTCCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-643s21c1
Sequence:CCGGGCAATCCACAGTCTCATATTTCTCGAGAAATATGAGACTGTGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-410s21c1
Sequence:CCGGATGCTATTGATCGGCACATTGCTCGAGCAATGTGCCGATCAATAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-569s21c1
Sequence:CCGGGCGATACAGTGGTCATCTATACTCGAGTATAGATGACCACTGTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198636
ACSS3 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA synthetase short-chain family member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198636.1-1703s1c1
Sequence:CCGGCCCTAGTATATGTGTTCCATTCTCGAGAATGGAACACATATACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-944s1c1
Sequence:CCGGGCATCCATTGTACATTCTCTACTCGAGTAGAGAATGTACAATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-1362s1c1
Sequence:CCGGGAGACCCTAGAATGGTCCAAACTCGAGTTTGGACCATTCTAGGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-368s1c1
Sequence:CCGGGCCTTCCACAAGTTGGTTTGTCTCGAGACAAACCAACTTGTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198636.1-712s1c1
Sequence:CCGGCGAAGCCTAAGGTGGTTGTTACTCGAGTAACAACCACCTTAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-1100s21c1
Sequence:CCGGTTGTTGGACATTCCTATATTTCTCGAGAAATATAGGAATGTCCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-643s21c1
Sequence:CCGGGCAATCCACAGTCTCATATTTCTCGAGAAATATGAGACTGTGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-410s21c1
Sequence:CCGGATGCTATTGATCGGCACATTGCTCGAGCAATGTGCCGATCAATAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198636.3-569s21c1
Sequence:CCGGGCGATACAGTGGTCATCTATACTCGAGTATAGATGACCACTGTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks