EMAIL THIS PAGE TO A FRIEND

ACTA1

actin, alpha 1, skeletal muscle

83 Gene Product Result for
Synonyms: ACTA ASMA CFTD CFTD1 CFTDM MPFD NEM1 NEM2 NEM3
UniProtKB ID: P68133, P02568, P99020, Q5T8M9
Gene ID:
Human(58) Summary: The product encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. Mutations in this gene cause nemaline myopathy type 3, congenital myopathy with excess of thin myofilaments, congenital myopathy with cores, and congenital myopathy with fiber-type disproportion, diseases that lead to muscle fiber defects. [provided by RefSeq, Jul 2008]
Mouse(11459) actin, alpha 1, skeletal muscle
Rat(29437) actin, alpha 1, skeletal muscle
chicken(421534) actin, alpha 1, skeletal muscle
Horse(100065454) actin, alpha 1, skeletal muscle
cow(281592) actin, alpha 1, skeletal muscle
domestic cat(101095439) actin, alpha 1, skeletal muscle
dog(488984) actin, alpha 1, skeletal muscle
naked mole-rat(101721383) actin, alpha 1, skeletal muscle
domestic guinea pig(100716933) actin, alpha 1, skeletal muscle
sheep(101107662) actin, alpha 1, skeletal muscle
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A5060 Anti-Actin (20-33) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution wide range (animal), invertebrates
immunofluorescence, immunohistochemistry, microarray, western blot pricing
A2668 Anti-Actin antibody produced in rabbit whole antiserum rat, chicken, human, mouse
immunofluorescence, western blot pricing
A2066 Anti-Actin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution amoeba, wide range, chicken, slime mold, vertebrates, human
immunofluorescence, immunohistochemistry, western blot pricing
A2103 Anti-Actin, N-terminal antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, frog, human, chicken, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502543 Anti-ACTIN-α-1, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4502631 Anti-Actin-pan antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
A2172 Monoclonal Anti-Actin (α-Sarcomeric) antibody produced in mouse clone 5C5, ascites fluid sheep, snake, human, rabbit, guinea pig, rat, frog, bovine, carp
ELISA, immunohistochemistry, western blot pricing
A3853 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunocytochemistry, immunohistochemistry, microarray, western blot pricing
A4700 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, ascites fluid goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C5838 Monoclonal Anti-Actin–Cy3 antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing
F3046 Monoclonal Anti-Actin–FITC antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0120 AQUA Peptide AVFPSIVG[R] chicken, dog, honey bee, human, mouse, pig, rat pricing
AQ0421 AQUA Peptide IWHHTFYNEL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115251 MISSION® esiRNA esiRNA human ACTA1 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
ABT1485 Anti-Actin 100 µL, This rabbit polyclonal Anti-Actin Antibody, Cat. No. ABT1485 is validated for use in Immunocytochemistry, Immunohistochemistry (Paraffin), and Western Blotting for the detection of Actin. pricing
ABT1485-AF488 Anti-Actin Antibody, Alexa Fluor® 488 Conjugate 100 µL, This rabbit polyclonal Anti-Actin, Alexa Fluor® 488 Conjugate, Cat. No. ABT1485-AF488 is validated for use in Flow Cytometry, Immunocytochemistry and Immunofluorescence applications for the detection of Actin. pricing
ABT1485-AF647 Anti-Actin Antibody, Alexa Fluor® 647 Conjugate 100 µL, This rabbit polyclonal Anti-Actin, Alexa Fluor® 647 Conjugate, Cat. No. ABT1485-AF647 s validated for use in Flow Cytometry, Immunocytochemistry and Immunofluorescence applications for the detection of Actin. pricing
MAB1501 Anti-Actin Antibody, clone C4 100 µL, Reliably and specifically detect actin using this Anti-Actin Antibody, clone C4. This highly published monoclonal antibody is validated for use in ELISA, IC, IF, IH, IH(P) & WB. This mAb is also available as a fluorescent conjugate. pricing
MAB1501X Anti-Actin Antibody, clone C4, Alexa Fluor® 488 conjugated 100 µg, Anti-Actin Antibody, clone C4, Alexa Fluor 488 conjugated detects level of Actin & has been published & validated for use in IF. pricing
MAB1501-AF555 Anti-Actin Antibody, clone C4, Alexa Fluor® 555 Conjugate 100 µL, This Anti-Actin Antibody, clone C4, Alexa Fluor® 555 Conjugate is validated for use in Immunocytochemistry for the detection of Actin. pricing
MAB1501-AF647 Anti-Actin Antibody, clone C4, Alexa Fluor® 647 conjugate 100 µL, This Anti-Actin Antibody, clone C4, Alexa Fluor® 647 conjugate is validated for use in Immunocytochemistry for the detection of Actin. pricing
MABT219 Anti-Actin Antibody, clone JLA20 100 µL, Detect Actin using this Anti-Actin Antibody, clone JLA20 validated for use in Western Blotting, Immunofluorescence. pricing
MAB1501R Anti-Actin Antibody, near a.a. 50-70, clone C4 100 µg, This Anti-Actin Antibody, near a.a. 50-70, clone C4 is validated for use in ELISA, IC, IH, IH(P), WB for the detection of Actin and has published in over 70 citations. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100 Rosetta Predictions human pricing
NM_019212 Rosetta Predictions rat pricing
NM_009606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137011 predicted 1221
2 SASI_Hs01_00137012 predicted 244
3 SASI_Hs01_00137016 predicted 584
4 SASI_Hs01_00137018 predicted 907
5 SASI_Hs01_00137019 predicted 483
6 SASI_Hs01_00137013 predicted 1253
7 SASI_Hs01_00137014 predicted 1020
8 SASI_Hs01_00137015 predicted 1261
9 SASI_Hs01_00137017 predicted 658
10 SASI_Hs01_00137020 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120005 predicted 687
2 SASI_Rn01_00120006 predicted 930
3 SASI_Rn01_00120007 predicted 443
4 SASI_Rn01_00120008 predicted 1206
5 SASI_Rn01_00120009 predicted 615
6 SASI_Rn01_00120010 predicted 409
7 SASI_Rn01_00120011 predicted 501
8 SASI_Rn01_00120012 predicted 434
9 SASI_Rn01_00120013 predicted 1206
10 SASI_Rn02_00262053 predicted 1211
11 SASI_Rn01_00120014 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071775 predicted 676
2 SASI_Mm01_00071777 predicted 972
3 SASI_Mm01_00071778 predicted 848
4 SASI_Mm01_00071781 predicted 908
5 SASI_Mm01_00071783 predicted 675
6 SASI_Mm01_00071784 predicted 1234
7 SASI_Mm02_00316534 predicted 1317
8 SASI_Mm02_00316535 predicted 973
9 SASI_Mm01_00071776 predicted 928
10 SASI_Mm01_00071779 predicted 1207
11 SASI_Mm01_00071780 predicted 506
12 SASI_Mm01_00071782 predicted 410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100
ACTA1 MISSION shRNA Bacterial Glycerol Stock
actin, alpha 1, skeletal muscle
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100.3-1262s21c1
Sequence:CCGGGACTTCTCAGGACGACGAATCCTCGAGGATTCGTCGTCCTGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100.3-989s21c1
Sequence:CCGGTGTATGCCAACAACGTCATGTCTCGAGACATGACGTTGTTGGCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001100.3-1317s1c1
Sequence:CCGGCCGCAGTCACTTTCTTTGTAACTCGAGTTACAAAGAAAGTGACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-939s1c1
Sequence:CCGGGACCACCTACAACAGCATCATCTCGAGATGATGCTGTTGTAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-336s1c1
Sequence:CCGGCATCACCAACTGGGATGACATCTCGAGATGTCATCCCAGTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-1113s1c1
Sequence:CCGGGCGCAAATACTCGGTGTGGATCTCGAGATCCACACCGAGTATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-589s1c1
Sequence:CCGGACCCACAACGTGCCCATTTATCTCGAGATAAATGGGCACGTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100
ACTA1 MISSION shRNA shRNA Plasmid DNA
actin, alpha 1, skeletal muscle
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100.3-1262s21c1
Sequence:CCGGGACTTCTCAGGACGACGAATCCTCGAGGATTCGTCGTCCTGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100.3-989s21c1
Sequence:CCGGTGTATGCCAACAACGTCATGTCTCGAGACATGACGTTGTTGGCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001100.3-1317s1c1
Sequence:CCGGCCGCAGTCACTTTCTTTGTAACTCGAGTTACAAAGAAAGTGACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-939s1c1
Sequence:CCGGGACCACCTACAACAGCATCATCTCGAGATGATGCTGTTGTAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-336s1c1
Sequence:CCGGCATCACCAACTGGGATGACATCTCGAGATGTCATCCCAGTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-1113s1c1
Sequence:CCGGGCGCAAATACTCGGTGTGGATCTCGAGATCCACACCGAGTATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-589s1c1
Sequence:CCGGACCCACAACGTGCCCATTTATCTCGAGATAAATGGGCACGTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100
ACTA1 MISSION shRNA Lentiviral Transduction Particles
actin, alpha 1, skeletal muscle
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100.3-1262s21c1
Sequence:CCGGGACTTCTCAGGACGACGAATCCTCGAGGATTCGTCGTCCTGAGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100.3-989s21c1
Sequence:CCGGTGTATGCCAACAACGTCATGTCTCGAGACATGACGTTGTTGGCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001100.3-1317s1c1
Sequence:CCGGCCGCAGTCACTTTCTTTGTAACTCGAGTTACAAAGAAAGTGACTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-939s1c1
Sequence:CCGGGACCACCTACAACAGCATCATCTCGAGATGATGCTGTTGTAGGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-336s1c1
Sequence:CCGGCATCACCAACTGGGATGACATCTCGAGATGTCATCCCAGTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-1113s1c1
Sequence:CCGGGCGCAAATACTCGGTGTGGATCTCGAGATCCACACCGAGTATTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001100.3-589s1c1
Sequence:CCGGACCCACAACGTGCCCATTTATCTCGAGATAAATGGGCACGTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009606
ACTA1 MISSION shRNA Bacterial Glycerol Stock
actin, alpha 1, skeletal muscle
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009606.1-1223s1c1
Sequence:CCGGCCTCAGGACGACAATCGACAACTCGAGTTGTCGATTGTCGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-506s1c1
Sequence:CCGGCCACCGGCATCGTGTTGGATTCTCGAGAATCCAACACGATGCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-849s1c1
Sequence:CCGGCCAGCCTTCCTTTATCGGTATCTCGAGATACCGATAAAGGAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-408s1c1
Sequence:CCGGCCGGGAGAAGATGACTCAAATCTCGAGATTTGAGTCATCTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-687s1c1
Sequence:CCGGTGTGCGCGACATCAAAGAGAACTCGAGTTCTCTTTGATGTCGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009606
ACTA1 MISSION shRNA shRNA Plasmid DNA
actin, alpha 1, skeletal muscle
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009606.1-1223s1c1
Sequence:CCGGCCTCAGGACGACAATCGACAACTCGAGTTGTCGATTGTCGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-506s1c1
Sequence:CCGGCCACCGGCATCGTGTTGGATTCTCGAGAATCCAACACGATGCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-849s1c1
Sequence:CCGGCCAGCCTTCCTTTATCGGTATCTCGAGATACCGATAAAGGAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-408s1c1
Sequence:CCGGCCGGGAGAAGATGACTCAAATCTCGAGATTTGAGTCATCTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-687s1c1
Sequence:CCGGTGTGCGCGACATCAAAGAGAACTCGAGTTCTCTTTGATGTCGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009606
ACTA1 MISSION shRNA Lentiviral Transduction Particles
actin, alpha 1, skeletal muscle
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009606.1-1223s1c1
Sequence:CCGGCCTCAGGACGACAATCGACAACTCGAGTTGTCGATTGTCGTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-506s1c1
Sequence:CCGGCCACCGGCATCGTGTTGGATTCTCGAGAATCCAACACGATGCCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-849s1c1
Sequence:CCGGCCAGCCTTCCTTTATCGGTATCTCGAGATACCGATAAAGGAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-408s1c1
Sequence:CCGGCCGGGAGAAGATGACTCAAATCTCGAGATTTGAGTCATCTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009606.1-687s1c1
Sequence:CCGGTGTGCGCGACATCAAAGAGAACTCGAGTTCTCTTTGATGTCGCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks