EMAIL THIS PAGE TO A FRIEND

ACTA2

actin, alpha 2, smooth muscle, aorta

Synonyms: AAT6 ACTSA MYMY5
UniProtKB ID: P62736, B2R8A4, P03996, P04108, Q6FI19
Gene ID:
Human(59) Summary: The protein encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. Defects in this gene cause aortic aneurysm familial thoracic type 6. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2008]
Mouse(11475) actin, alpha 2, smooth muscle, aorta
Rat(81633) actin, alpha 2, smooth muscle, aorta
Zebrafish(322509) actin, alpha 2, smooth muscle, aorta
chicken(423787) actin, alpha 2, smooth muscle, aorta
domestic cat(101093547) actin, alpha 2, smooth muscle, aorta
cow(515610) actin, alpha 2, smooth muscle, aorta
Horse(100062175) actin, alpha 2, smooth muscle, aorta
dog(477587) actin, alpha 2, smooth muscle, aorta
naked mole-rat(101718388) actin, alpha 2, smooth muscle, aorta
domestic guinea pig(100722917) actin, alpha 2, smooth muscle, aorta
sheep(101121051) actin, alpha 2, smooth muscle, aorta
Domestic Rabbit(100009271) actin, alpha 2, smooth muscle, aorta
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2701868 Anti-acta2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
SAB2701827 Anti-acta2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701828 Anti-acta2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701689 Anti-acta2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701690 Anti-acta2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
C6198 Anti-Actin, α-Smooth Muscle - Cy3 antibody, Mouse monoclonal clone 1A4, purified from hybridoma cell culture rabbit, mouse, guinea pig, chicken, goat, sheep, snake, human, frog, rat, canine, bovine
immunohistochemistry pricing
A5228 Anti-Actin, α-Smooth Muscle antibody, Mouse monoclonal clone 1A4, purified from hybridoma cell culture rabbit, mouse, guinea pig, chicken, goat, sheep, snake, human, frog, rat, canine, bovine
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, microarray, western blot pricing
A2103 Anti-Actin, N-terminal antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, frog, human, chicken, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB5500002 Anti-SMA antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP171, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB2500963 Anti-Smooth Muscle α-Actin antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
WH0000059M2 Monoclonal Anti-ACTA2 antibody produced in mouse clone 4A8-2H3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403519 Monoclonal Anti-ACTA2 antibody produced in mouse clone 1D11-2B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
A3853 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunocytochemistry, immunohistochemistry, microarray, western blot pricing
A4700 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, ascites fluid goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
A2547 Monoclonal Anti-Actin, α-Smooth Muscle clone 1A4, ascites fluid rabbit, mouse, guinea pig, chicken, goat, sheep, snake, human, frog, rat, canine, bovine
immunofluorescence, immunohistochemistry, western blot pricing
A5691 Monoclonal Anti-Actin, α-Smooth Muscle - Alkaline Phosphatase antibody produced in mouse clone 1A4, purified immunoglobulin, buffered aqueous glycerol solution rabbit, mouse, guinea pig, chicken, goat, sheep, snake, human, frog, rat, canine, bovine
ELISA, immunohistochemistry, western blot pricing
F3777 Monoclonal Anti-Actin, α-Smooth Muscle - FITC antibody produced in mouse clone 1A4, purified immunoglobulin, buffered aqueous solution rabbit, mouse, guinea pig, chicken, goat, sheep, snake, human, frog, rat, canine, bovine
immunohistochemistry pricing
A7607 Monoclonal Anti-Actin, Smooth Muscle antibody produced in mouse ~1.0 mg/mL, clone CGA7, purified immunoglobulin, buffered aqueous solution monkey, chicken, human, rat, mouse
ELISA, immunocytochemistry, immunohistochemistry, western blot pricing
C5838 Monoclonal Anti-Actin–Cy3 antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing
F3046 Monoclonal Anti-Actin–FITC antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0120 AQUA Peptide AVFPSIVG[R] chicken, dog, honey bee, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001613 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001613 Rosetta Predictions human pricing
NM_031004 Rosetta Predictions rat pricing
NM_007392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097016 predicted 782
2 SASI_Hs01_00097017 predicted 685
3 SASI_Hs01_00097021 predicted 429
4 SASI_Hs01_00097022 predicted 312
5 SASI_Hs02_00332169 predicted 837
6 SASI_Hs01_00097014 predicted 635
7 SASI_Hs01_00097015 predicted 667
8 SASI_Hs01_00097018 predicted 902
9 SASI_Hs01_00097019 predicted 660
10 SASI_Hs01_00097020 predicted 692
11 SASI_Hs01_00097023 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264183 predicted 520
2 SASI_Rn02_00264184 predicted 915
3 SASI_Rn02_00264185 predicted 527
4 SASI_Rn02_00264186 predicted 478
5 SASI_Rn02_00264187 predicted 850
6 SASI_Rn02_00264188 predicted 534
7 SASI_Rn02_00264189 predicted 260
8 SASI_Rn02_00264190 predicted 555
9 SASI_Rn02_00264191 predicted 502
10 SASI_Rn02_00264192 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164855 predicted 546
2 SASI_Mm01_00164856 predicted 690
3 SASI_Mm01_00164857 predicted 497
4 SASI_Mm01_00164858 predicted 1295
5 SASI_Mm01_00164861 predicted 921
6 SASI_Mm02_00311498 predicted 1382
7 SASI_Mm02_00311499 predicted 1362
8 SASI_Mm02_00311500 predicted 1387
9 SASI_Mm02_00311501 predicted 1387
10 SASI_Mm02_00311502 predicted 1359
11 SASI_Mm01_00164859 predicted 1374
12 SASI_Mm01_00164860 predicted 1325
13 SASI_Mm01_00164862 predicted 1225
14 SASI_Mm01_00164863 predicted 1402
15 SASI_Mm01_00164864 predicted 1435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007392
ACTA2 MISSION shRNA Bacterial Glycerol Stock
actin, alpha 2, smooth muscle, aorta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007392.2-1362s1c1
Sequence:CCGGGCCTAGCAACACTGATTCAATCTCGAGATTGAATCAGTGTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-196s1c1
Sequence:CCGGTCAGGGAGTAATGGTTGGAATCTCGAGATTCCAACCATTACTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-894s1c1
Sequence:CCGGGCATCCACGAAACCACCTATACTCGAGTATAGGTGGTTTCGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-269s1c1
Sequence:CCGGCTGACGCTGAAGTATCCGATACTCGAGTATCGGATACTTCAGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-338s1c1
Sequence:CCGGCACTCTTTCTATAACGAGCTTCTCGAGAAGCTCGTTATAGAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007392.2-1389s21c1
Sequence:CCGGTCTGTTAGGTGAGAATCATTTCTCGAGAAATGATTCTCACCTAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007392.2-1541s21c1
Sequence:CCGGAGAGCGTATAGGACTTGTATACTCGAGTATACAAGTCCTATACGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007392.2-551s21c1
Sequence:CCGGGTGACTCACAACGTGCCTATCCTCGAGGATAGGCACGTTGTGAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007392
ACTA2 MISSION shRNA shRNA Plasmid DNA
actin, alpha 2, smooth muscle, aorta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007392.2-1362s1c1
Sequence:CCGGGCCTAGCAACACTGATTCAATCTCGAGATTGAATCAGTGTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-196s1c1
Sequence:CCGGTCAGGGAGTAATGGTTGGAATCTCGAGATTCCAACCATTACTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-894s1c1
Sequence:CCGGGCATCCACGAAACCACCTATACTCGAGTATAGGTGGTTTCGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-269s1c1
Sequence:CCGGCTGACGCTGAAGTATCCGATACTCGAGTATCGGATACTTCAGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-338s1c1
Sequence:CCGGCACTCTTTCTATAACGAGCTTCTCGAGAAGCTCGTTATAGAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007392.2-1389s21c1
Sequence:CCGGTCTGTTAGGTGAGAATCATTTCTCGAGAAATGATTCTCACCTAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007392.2-1541s21c1
Sequence:CCGGAGAGCGTATAGGACTTGTATACTCGAGTATACAAGTCCTATACGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007392.2-551s21c1
Sequence:CCGGGTGACTCACAACGTGCCTATCCTCGAGGATAGGCACGTTGTGAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007392
ACTA2 MISSION shRNA Lentiviral Transduction Particles
actin, alpha 2, smooth muscle, aorta
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007392.2-1362s1c1
Sequence:CCGGGCCTAGCAACACTGATTCAATCTCGAGATTGAATCAGTGTTGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-196s1c1
Sequence:CCGGTCAGGGAGTAATGGTTGGAATCTCGAGATTCCAACCATTACTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-894s1c1
Sequence:CCGGGCATCCACGAAACCACCTATACTCGAGTATAGGTGGTTTCGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-269s1c1
Sequence:CCGGCTGACGCTGAAGTATCCGATACTCGAGTATCGGATACTTCAGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007392.2-338s1c1
Sequence:CCGGCACTCTTTCTATAACGAGCTTCTCGAGAAGCTCGTTATAGAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007392.2-1389s21c1
Sequence:CCGGTCTGTTAGGTGAGAATCATTTCTCGAGAAATGATTCTCACCTAACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007392.2-1541s21c1
Sequence:CCGGAGAGCGTATAGGACTTGTATACTCGAGTATACAAGTCCTATACGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007392.2-551s21c1
Sequence:CCGGGTGACTCACAACGTGCCTATCCTCGAGGATAGGCACGTTGTGAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001613
VALIDATED
ACTA2 MISSION shRNA Bacterial Glycerol Stock
actin, alpha 2, smooth muscle, aorta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001613.1-260s1c1
Sequence:CCGGCCCGATAGAACATGGCATCATCTCGAGATGATGCCATGTTCTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001613.1-262s1c1
Sequence:CCGGCGATAGAACATGGCATCATCACTCGAGTGATGATGCCATGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001613.1-668s1c1
Sequence:CCGGGCGTGAGATTGTCCGGGACATCTCGAGATGTCCCGGACAATCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001613.1-758s1c1
Sequence:CCGGCCTTGAGAAGAGTTACGAGTTCTCGAGAACTCGTAACTCTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001613.1-788s1c1
Sequence:CCGGGCAAGTGATCACCATCGGAAACTCGAGTTTCCGATGGTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001613.2-737s21c1
Sequence:CCGGGCGTGAGATTGTCCGGGACATCTCGAGATGTCCCGGACAATCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001613.2-857s21c1
Sequence:CCGGGCAAGTGATCACCATCGGAAACTCGAGTTTCCGATGGTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001613.2-329s21c1
Sequence:CCGGCCCGATAGAACATGGCATCATCTCGAGATGATGCCATGTTCTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001613.2-827s21c1
Sequence:CCGGCCTTGAGAAGAGTTACGAGTTCTCGAGAACTCGTAACTCTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001613
VALIDATED
ACTA2 MISSION shRNA shRNA Plasmid DNA
actin, alpha 2, smooth muscle, aorta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001613.1-260s1c1
Sequence:CCGGCCCGATAGAACATGGCATCATCTCGAGATGATGCCATGTTCTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001613.1-262s1c1
Sequence:CCGGCGATAGAACATGGCATCATCACTCGAGTGATGATGCCATGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001613.1-668s1c1
Sequence:CCGGGCGTGAGATTGTCCGGGACATCTCGAGATGTCCCGGACAATCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001613.1-758s1c1
Sequence:CCGGCCTTGAGAAGAGTTACGAGTTCTCGAGAACTCGTAACTCTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001613.1-788s1c1
Sequence:CCGGGCAAGTGATCACCATCGGAAACTCGAGTTTCCGATGGTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001613.2-737s21c1
Sequence:CCGGGCGTGAGATTGTCCGGGACATCTCGAGATGTCCCGGACAATCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001613.2-857s21c1
Sequence:CCGGGCAAGTGATCACCATCGGAAACTCGAGTTTCCGATGGTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001613.2-329s21c1
Sequence:CCGGCCCGATAGAACATGGCATCATCTCGAGATGATGCCATGTTCTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001613.2-827s21c1
Sequence:CCGGCCTTGAGAAGAGTTACGAGTTCTCGAGAACTCGTAACTCTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001613
VALIDATED
ACTA2 MISSION shRNA Lentiviral Transduction Particles
actin, alpha 2, smooth muscle, aorta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001613.1-260s1c1
Sequence:CCGGCCCGATAGAACATGGCATCATCTCGAGATGATGCCATGTTCTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001613.1-262s1c1
Sequence:CCGGCGATAGAACATGGCATCATCACTCGAGTGATGATGCCATGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001613.1-668s1c1
Sequence:CCGGGCGTGAGATTGTCCGGGACATCTCGAGATGTCCCGGACAATCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001613.1-758s1c1
Sequence:CCGGCCTTGAGAAGAGTTACGAGTTCTCGAGAACTCGTAACTCTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001613.1-788s1c1
Sequence:CCGGGCAAGTGATCACCATCGGAAACTCGAGTTTCCGATGGTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001613.2-737s21c1
Sequence:CCGGGCGTGAGATTGTCCGGGACATCTCGAGATGTCCCGGACAATCTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001613.2-857s21c1
Sequence:CCGGGCAAGTGATCACCATCGGAAACTCGAGTTTCCGATGGTGATCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001613.2-329s21c1
Sequence:CCGGCCCGATAGAACATGGCATCATCTCGAGATGATGCCATGTTCTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001613.2-827s21c1
Sequence:CCGGCCTTGAGAAGAGTTACGAGTTCTCGAGAACTCGTAACTCTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks