EMAIL THIS PAGE TO A FRIEND

ACTB

actin, beta

88 Gene Product Result for
Synonyms: BRWS1 PS1TP5BP1
Gene ID:
Human(60) Summary: This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, and integrity. This actin is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins. [provided by RefSeq, Jul 2008]
Mouse(11461) actin, beta
Rat(81822) actin, beta
chicken(396526) actin, beta
cow(280979) actin, beta
Horse(100033878) actin, beta
dog(403580) actin, beta
Goat(100860883) actin, beta
sheep(443052) actin, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108641 Anti-ACTB affinity isolated antibody horse, goat, canine, pig, human, zebrafish, bovine, rat, sheep
immunohistochemistry, western blot pricing
AV40173 Anti-ACTB antibody produced in rabbit affinity isolated antibody, lyophilized powder human
western blot pricing
SAB2100037 Anti-ACTB antibody produced in rabbit affinity isolated antibody rat, bovine, pig, zebrafish, horse, Caenorhabditis elegans, sheep, human, mouse, goat
western blot pricing
HPA041264 Anti-ACTB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
HPA041271 Anti-ACTB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
GW23014 Anti-Actin, Cytoplasmic 1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
A2103 Anti-Actin, N-terminal antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, frog, human, chicken, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
GW23017 Anti-Actin, Non-muscle (β and γ) antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB5500001 Anti-Actin-Beta antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP124, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB4502632 Anti-Actin-pan, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB3500350 Anti-β-Actin antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
A1978 Anti-β-Actin antibody, Mouse monoclonal clone AC-15, purified from hybridoma cell culture canine, guinea pig, Hirudo medicinalis, feline, pig, mouse, carp, chicken, sheep, rabbit, rat, human, bovine
immunocytochemistry, immunofluorescence, immunohistochemistry, microarray, western blot pricing
F3022 Anti-β-Actin–FITC antibody, Mouse monoclonal clone AC-15, purified from hybridoma cell culture canine, guinea pig, Hirudo medicinalis, feline, pig, mouse, carp, chicken, sheep, rabbit, rat, human, bovine
immunofluorescence pricing
WH0000060M1 Monoclonal Anti-ACTB antibody produced in mouse clone 3G4-F9, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB1403520 Monoclonal Anti-ACTB antibody produced in mouse clone 1E7, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
AMAB91241 Monoclonal Anti-ACTB antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3868, purified immunoglobulin, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
A3853 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunocytochemistry, immunohistochemistry, microarray, western blot pricing
A4700 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, ascites fluid goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C5838 Monoclonal Anti-Actin–Cy3 antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing
F3046 Monoclonal Anti-Actin–FITC antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing
A2228 Monoclonal Anti-β-Actin antibody produced in mouse clone AC-74, purified immunoglobulin, buffered aqueous solution canine, guinea pig, rabbit, bovine, chicken, rat, sheep, wide range, carp, Drosophila, Hirudo medicinalis, cat, human, mouse, pig
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
A5316 Monoclonal Anti-β-Actin antibody produced in mouse clone AC-74, ascites fluid canine, guinea pig, rabbit, bovine, chicken, rat, sheep, wide range, carp, Drosophila, Hirudo medicinalis, cat, human, mouse, pig
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
A5441 Monoclonal Anti-β-Actin antibody produced in mouse clone AC-15, ascites fluid canine, guinea pig, Hirudo medicinalis, feline, pig, mouse, carp, chicken, sheep, rabbit, rat, human, bovine
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
A3854 Monoclonal Anti-β-Actin−Peroxidase antibody produced in mouse clone AC-15, purified from hybridoma cell culture canine, guinea pig, Hirudo medicinalis, feline, pig, mouse, carp, chicken, sheep, rabbit, rat, human, bovine
western blot pricing
SAB1305567 MONOCLONAL ANTI-BETA-ACTIN antibody produced in mouse clone 8H10D10, crude ascites, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305554 MONOCLONAL ANTI-BETA-ACTIN antibody produced in mouse clone 137CT26.1.1, IgG fraction of antiserum, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB1305546 MONOCLONAL ANTI-BETA-ACTIN antibody produced in mouse clone 8H10D10, IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0120 AQUA Peptide AVFPSIVG[R] chicken, dog, honey bee, human, mouse, pig, rat pricing
AQ0421 AQUA Peptide IWHHTFYNEL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073351 MISSION® esiRNA esiRNA human ACTB (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
AB3265 Anti-Actin γ Antibody 100 µL, Anti-Actin Antibody, γ is an antibody against Actin for use in IC, IH & WB. pricing
ABT264 Anti-beta Actin Antibody, arginylated (N-terminal) 100 μg, This Anti-beta Actin Antibody, arginylated (N-terminal) is validated for use in Dot Blot, Immunocytochemistry, and Western Blotting for the detection of beta Actin N-terminal arginylation. pricing
MABT825 Anti-beta-Actin Antibody, clone 4C2 100 μg, This Anti-beta-Actin Antibody, clone 4C2 is validated for use in Western Blotting, Immunocytochemistry for the detection of beta-Actin. pricing
AB3150 Anti-Fractin Antibody, CT 100 µL, Detect Fractin using this Anti-Fractin Antibody, C-terminus validated for use in WB, IC, IH(P). pricing
SF-145 Beta Actin; Human, Cyanine 3, RNA Detection Probe | SmartFlare 250 reactions, SmartFlare Beta Actin; Human, Cyanine 3 is a RNA Detection probe that targets the ACTB housekeeping gene. Use housekeeping controls as a proof of concept for your gene expression experiments or as a positive control for gene modulation experiments. pricing
SF-144 Beta Actin; Human, Cyanine 5, RNA Detection Probe | SmartFlare 250 reactions, SmartFlare Beta Actin; Human, Cyanine 5 is a RNA Detection probe that targets the ACTB housekeeping gene. Use housekeeping controls as a proof of concept for your gene expression experiments or as a positive control for gene modulation experiments. pricing
17-10204 LentiBrite™ GFP-β-actin Lentiviral Biosensor 1 vial (minimum of 3 x 10E8 IFU/mL) pricing
17-10203 LentiBrite™ RFP-β-actin Lentiviral Biosensor 1 vial (minimum of 3 x 10E8 IFU/mL) pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101 Rosetta Predictions human pricing
NM_031144 Rosetta Predictions rat pricing
NM_007393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204238 predicted 465
2 SASI_Hs01_00204239 predicted 1197
3 SASI_Hs02_00322555 predicted 1470
4 SASI_Hs01_00204240 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106127 predicted 928
2 SASI_Rn01_00106128 predicted 734
3 SASI_Rn01_00106130 predicted 406
4 SASI_Rn01_00106132 predicted 498
5 SASI_Rn01_00106133 predicted 829
6 SASI_Rn02_00264481 predicted 884
7 SASI_Rn01_00106134 predicted 895
8 SASI_Rn02_00264482 predicted 723
9 SASI_Rn01_00106136 predicted 902
10 SASI_Rn02_00264483 predicted 688
11 SASI_Rn01_00106129 predicted 599
12 SASI_Rn01_00106131 predicted 402
13 SASI_Rn01_00106135 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311503 predicted 297
2 SASI_Mm01_00121593 predicted 931
3 SASI_Mm02_00311504 predicted 1205
4 SASI_Mm01_00121588 predicted 679
5 SASI_Mm01_00121589 predicted 507
6 SASI_Mm01_00121590 predicted 725
7 SASI_Mm01_00121591 predicted 840
8 SASI_Mm01_00121592 predicted 892
9 SASI_Mm01_00121594 predicted 894
10 SASI_Mm01_00121595 predicted 415
11 SASI_Mm01_00121596 predicted 870
12 SASI_Mm01_00121597 predicted 907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007393
VALIDATED
ACTB MISSION shRNA Bacterial Glycerol Stock
actin, beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-810s21c1
Sequence:CCGGACGGCCAGGTCATCACTATTGCTCGAGCAATAGTGATGACCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-1649s21c1
Sequence:CCGGGCATTGCTTCTGTGTAAATTACTCGAGTAATTTACACAGAAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-1464s21c1
Sequence:CCGGGGCTGAGGACTTTGTACATTGCTCGAGCAATGTACAAAGTCCTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-703s21c1
Sequence:CCGGCGTGCGTGACATCAAAGAGAACTCGAGTTCTCTTTGATGTCACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-869s21c1
Sequence:CCGGCCTTCCTTCTTGGGTATGGAACTCGAGTTCCATACCCAAGAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007393.1-440s1c1
Sequence:CCGGCCAGATCATGTTTGAGACCTTCTCGAGAAGGTCTCAAACATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007393.1-1652s1c1
Sequence:CCGGGCATTGCTTCTGTGTAAATTACTCGAGTAATTTACACAGAAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007393.1-289s1c1
Sequence:CCGGCCATTGAACATGGCATTGTTACTCGAGTAACAATGCCATGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007393.1-704s1c1
Sequence:CCGGCGTGCGTGACATCAAAGAGAACTCGAGTTCTCTTTGATGTCACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007393.1-870s1c1
Sequence:CCGGCCTTCCTTCTTGGGTATGGAACTCGAGTTCCATACCCAAGAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007393
VALIDATED
ACTB MISSION shRNA shRNA Plasmid DNA
actin, beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-810s21c1
Sequence:CCGGACGGCCAGGTCATCACTATTGCTCGAGCAATAGTGATGACCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-1649s21c1
Sequence:CCGGGCATTGCTTCTGTGTAAATTACTCGAGTAATTTACACAGAAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-1464s21c1
Sequence:CCGGGGCTGAGGACTTTGTACATTGCTCGAGCAATGTACAAAGTCCTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-703s21c1
Sequence:CCGGCGTGCGTGACATCAAAGAGAACTCGAGTTCTCTTTGATGTCACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-869s21c1
Sequence:CCGGCCTTCCTTCTTGGGTATGGAACTCGAGTTCCATACCCAAGAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007393.1-440s1c1
Sequence:CCGGCCAGATCATGTTTGAGACCTTCTCGAGAAGGTCTCAAACATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007393.1-1652s1c1
Sequence:CCGGGCATTGCTTCTGTGTAAATTACTCGAGTAATTTACACAGAAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007393.1-289s1c1
Sequence:CCGGCCATTGAACATGGCATTGTTACTCGAGTAACAATGCCATGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007393.1-704s1c1
Sequence:CCGGCGTGCGTGACATCAAAGAGAACTCGAGTTCTCTTTGATGTCACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007393.1-870s1c1
Sequence:CCGGCCTTCCTTCTTGGGTATGGAACTCGAGTTCCATACCCAAGAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007393
VALIDATED
ACTB MISSION shRNA Lentiviral Transduction Particles
actin, beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-810s21c1
Sequence:CCGGACGGCCAGGTCATCACTATTGCTCGAGCAATAGTGATGACCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-1649s21c1
Sequence:CCGGGCATTGCTTCTGTGTAAATTACTCGAGTAATTTACACAGAAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-1464s21c1
Sequence:CCGGGGCTGAGGACTTTGTACATTGCTCGAGCAATGTACAAAGTCCTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-703s21c1
Sequence:CCGGCGTGCGTGACATCAAAGAGAACTCGAGTTCTCTTTGATGTCACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007393.3-869s21c1
Sequence:CCGGCCTTCCTTCTTGGGTATGGAACTCGAGTTCCATACCCAAGAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007393.1-440s1c1
Sequence:CCGGCCAGATCATGTTTGAGACCTTCTCGAGAAGGTCTCAAACATGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007393.1-1652s1c1
Sequence:CCGGGCATTGCTTCTGTGTAAATTACTCGAGTAATTTACACAGAAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007393.1-289s1c1
Sequence:CCGGCCATTGAACATGGCATTGTTACTCGAGTAACAATGCCATGTTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007393.1-704s1c1
Sequence:CCGGCGTGCGTGACATCAAAGAGAACTCGAGTTCTCTTTGATGTCACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007393.1-870s1c1
Sequence:CCGGCCTTCCTTCTTGGGTATGGAACTCGAGTTCCATACCCAAGAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101
VALIDATED
ACTB MISSION shRNA Bacterial Glycerol Stock
actin, beta
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101.3-432s21c1
Sequence:CCGGCGAGAAGATGACCCAGATCATCTCGAGATGATCTGGGTCATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101.3-1489s21c1
Sequence:CCGGGAAGTCCCTTGCCATCCTAAACTCGAGTTTAGGATGGCAAGGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101.3-1465s21c1
Sequence:CCGGCAAATATGAGATGCGTTGTTACTCGAGTAACAACGCATCTCATATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101.3-909s21c1
Sequence:CCGGCGAAACTACCTTCAACTCCATCTCGAGATGGAGTTGAAGGTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001101.2-421s1c1
Sequence:CCGGCGAGAAGATGACCCAGATCATCTCGAGATGATCTGGGTCATCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001101.2-898s1c1
Sequence:CCGGCGAAACTACCTTCAACTCCATCTCGAGATGGAGTTGAAGGTAGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001101.2-697s1c1
Sequence:CCGGCGTGCGTGACATTAAGGAGAACTCGAGTTCTCCTTAATGTCACGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001101.2-473s1c1
Sequence:CCGGGTTGCTATCCAGGCTGTGCTACTCGAGTAGCACAGCCTGGATAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101
VALIDATED
ACTB MISSION shRNA shRNA Plasmid DNA
actin, beta
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101.3-432s21c1
Sequence:CCGGCGAGAAGATGACCCAGATCATCTCGAGATGATCTGGGTCATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101.3-1489s21c1
Sequence:CCGGGAAGTCCCTTGCCATCCTAAACTCGAGTTTAGGATGGCAAGGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101.3-1465s21c1
Sequence:CCGGCAAATATGAGATGCGTTGTTACTCGAGTAACAACGCATCTCATATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101.3-909s21c1
Sequence:CCGGCGAAACTACCTTCAACTCCATCTCGAGATGGAGTTGAAGGTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001101.2-421s1c1
Sequence:CCGGCGAGAAGATGACCCAGATCATCTCGAGATGATCTGGGTCATCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001101.2-898s1c1
Sequence:CCGGCGAAACTACCTTCAACTCCATCTCGAGATGGAGTTGAAGGTAGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001101.2-697s1c1
Sequence:CCGGCGTGCGTGACATTAAGGAGAACTCGAGTTCTCCTTAATGTCACGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001101.2-473s1c1
Sequence:CCGGGTTGCTATCCAGGCTGTGCTACTCGAGTAGCACAGCCTGGATAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101
VALIDATED
ACTB MISSION shRNA Lentiviral Transduction Particles
actin, beta
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101.3-432s21c1
Sequence:CCGGCGAGAAGATGACCCAGATCATCTCGAGATGATCTGGGTCATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101.3-1489s21c1
Sequence:CCGGGAAGTCCCTTGCCATCCTAAACTCGAGTTTAGGATGGCAAGGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101.3-1465s21c1
Sequence:CCGGCAAATATGAGATGCGTTGTTACTCGAGTAACAACGCATCTCATATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101.3-909s21c1
Sequence:CCGGCGAAACTACCTTCAACTCCATCTCGAGATGGAGTTGAAGGTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001101.2-421s1c1
Sequence:CCGGCGAGAAGATGACCCAGATCATCTCGAGATGATCTGGGTCATCTTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001101.2-898s1c1
Sequence:CCGGCGAAACTACCTTCAACTCCATCTCGAGATGGAGTTGAAGGTAGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001101.2-697s1c1
Sequence:CCGGCGTGCGTGACATTAAGGAGAACTCGAGTTCTCCTTAATGTCACGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001101.2-473s1c1
Sequence:CCGGGTTGCTATCCAGGCTGTGCTACTCGAGTAGCACAGCCTGGATAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks