EMAIL THIS PAGE TO A FRIEND

ACTBL2

actin, beta-like 2

Synonyms: ACT
UniProtKB ID: Q562R1, B2RPJ1, Q562R2, Q562S9, Q562X8
Gene ID:
Mouse(238880) actin, beta-like 2
Rat(294732) actin, beta-like 2
chicken(426652) actin, beta-like 2
dog(487218) actin, beta-like 2
domestic cat(101091843) actin, beta-like 2
cow(780991) actin, beta-like 2
naked mole-rat(101717420) actin, beta-like 2
domestic guinea pig(100720973) actin, beta-like 2
sheep(101110871) actin, beta-like 2
Gene Class: Cytoskeleton
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0120 AQUA Peptide AVFPSIVG[R] chicken, dog, honey bee, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001017992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017992 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007941 MISSION® esiRNA esiRNA targeting human ACTBL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017992 Rosetta Predictions human pricing
NM_001106409 Rosetta Predictions rat pricing
NM_175497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123359 predicted 721
2 SASI_Hs01_00123360 predicted 689
3 SASI_Hs01_00123361 predicted 1107
4 SASI_Hs01_00123363 predicted 456
5 SASI_Hs01_00123364 predicted 577
6 SASI_Hs01_00123365 predicted 1100
7 SASI_Hs01_00123367 predicted 1234
8 SASI_Hs01_00123368 predicted 1176
9 SASI_Hs02_00306879 predicted 1166
10 SASI_Hs02_00306880 predicted 1236
11 SASI_Hs01_00123362 predicted 931
12 SASI_Hs01_00123366 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218678 predicted 1314
2 SASI_Rn02_00218679 predicted 913
3 SASI_Rn02_00218680 predicted 974
4 SASI_Rn02_00218681 predicted 491
5 SASI_Rn02_00218682 predicted 508
6 SASI_Rn02_00218683 predicted 1202
7 SASI_Rn02_00218684 predicted 835
8 SASI_Rn02_00218685 predicted 711
9 SASI_Rn02_00218686 predicted 509
10 SASI_Rn02_00218687 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036264 predicted 974
2 SASI_Mm01_00036266 predicted 1307
3 SASI_Mm01_00036267 predicted 943
4 SASI_Mm01_00036268 predicted 704
5 SASI_Mm01_00036269 predicted 1065
6 SASI_Mm02_00346410 predicted 828
7 SASI_Mm01_00036270 predicted 478
8 SASI_Mm01_00036271 predicted 304
9 SASI_Mm01_00036272 predicted 409
10 SASI_Mm01_00036273 predicted 1322
11 SASI_Mm01_00036265 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175497
ACTBL2 MISSION shRNA Bacterial Glycerol Stock
actin, beta-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175497.2-2530s1c1
Sequence:CCGGCCCTTCTCTTTCATATTAGTTCTCGAGAACTAATATGAAAGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-1063s1c1
Sequence:CCGGGCAGAAGGAAATTGTAACCTTCTCGAGAAGGTTACAATTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-914s1c1
Sequence:CCGGCCTTCCTTTCTAGGCATTGAACTCGAGTTCAATGCCTAGAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-416s1c1
Sequence:CCGGCCGGATGAACATCCTATTCTTCTCGAGAAGAATAGGATGTTCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-1127s1c1
Sequence:CCGGCGCAAGTATTCGGTTTGGATTCTCGAGAATCCAAACCGAATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175497
ACTBL2 MISSION shRNA shRNA Plasmid DNA
actin, beta-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175497.2-2530s1c1
Sequence:CCGGCCCTTCTCTTTCATATTAGTTCTCGAGAACTAATATGAAAGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-1063s1c1
Sequence:CCGGGCAGAAGGAAATTGTAACCTTCTCGAGAAGGTTACAATTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-914s1c1
Sequence:CCGGCCTTCCTTTCTAGGCATTGAACTCGAGTTCAATGCCTAGAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-416s1c1
Sequence:CCGGCCGGATGAACATCCTATTCTTCTCGAGAAGAATAGGATGTTCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-1127s1c1
Sequence:CCGGCGCAAGTATTCGGTTTGGATTCTCGAGAATCCAAACCGAATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175497
ACTBL2 MISSION shRNA Lentiviral Transduction Particles
actin, beta-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175497.2-2530s1c1
Sequence:CCGGCCCTTCTCTTTCATATTAGTTCTCGAGAACTAATATGAAAGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-1063s1c1
Sequence:CCGGGCAGAAGGAAATTGTAACCTTCTCGAGAAGGTTACAATTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-914s1c1
Sequence:CCGGCCTTCCTTTCTAGGCATTGAACTCGAGTTCAATGCCTAGAAAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-416s1c1
Sequence:CCGGCCGGATGAACATCCTATTCTTCTCGAGAAGAATAGGATGTTCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175497.2-1127s1c1
Sequence:CCGGCGCAAGTATTCGGTTTGGATTCTCGAGAATCCAAACCGAATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017992
ACTBL2 MISSION shRNA Bacterial Glycerol Stock
actin, beta-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-592s1c1
Sequence:CCGGCGTGCCCATCTATGAAGGTTACTCGAGTAACCTTCATAGATGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017992.1-1239s1c1
Sequence:CCGGGCTTCCATATTAGTGGGCTTACTCGAGTAAGCCCACTAATATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-1109s1c1
Sequence:CCGGCGGAAGTATTCTGTTTGGATTCTCGAGAATCCAAACAGAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-466s1c1
Sequence:CCGGTCAGATCATGTTCGAGGCTTTCTCGAGAAAGCCTCGAACATGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-962s1c1
Sequence:CCGGGATGTGGATATTCGCAAGGATCTCGAGATCCTTGCGAATATCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017992.2-682s21c1
Sequence:CCGGCTGACAGAGCGAGGCTATAACCTCGAGGTTATAGCCTCGCTCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017992.2-725s21c1
Sequence:CCGGAGATTGTGCGAGATGTCAAAGCTCGAGCTTTGACATCTCGCACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017992
ACTBL2 MISSION shRNA shRNA Plasmid DNA
actin, beta-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-592s1c1
Sequence:CCGGCGTGCCCATCTATGAAGGTTACTCGAGTAACCTTCATAGATGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017992.1-1239s1c1
Sequence:CCGGGCTTCCATATTAGTGGGCTTACTCGAGTAAGCCCACTAATATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-1109s1c1
Sequence:CCGGCGGAAGTATTCTGTTTGGATTCTCGAGAATCCAAACAGAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-466s1c1
Sequence:CCGGTCAGATCATGTTCGAGGCTTTCTCGAGAAAGCCTCGAACATGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-962s1c1
Sequence:CCGGGATGTGGATATTCGCAAGGATCTCGAGATCCTTGCGAATATCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017992.2-682s21c1
Sequence:CCGGCTGACAGAGCGAGGCTATAACCTCGAGGTTATAGCCTCGCTCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017992.2-725s21c1
Sequence:CCGGAGATTGTGCGAGATGTCAAAGCTCGAGCTTTGACATCTCGCACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017992
ACTBL2 MISSION shRNA Lentiviral Transduction Particles
actin, beta-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-592s1c1
Sequence:CCGGCGTGCCCATCTATGAAGGTTACTCGAGTAACCTTCATAGATGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017992.1-1239s1c1
Sequence:CCGGGCTTCCATATTAGTGGGCTTACTCGAGTAAGCCCACTAATATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-1109s1c1
Sequence:CCGGCGGAAGTATTCTGTTTGGATTCTCGAGAATCCAAACAGAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-466s1c1
Sequence:CCGGTCAGATCATGTTCGAGGCTTTCTCGAGAAAGCCTCGAACATGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017992.1-962s1c1
Sequence:CCGGGATGTGGATATTCGCAAGGATCTCGAGATCCTTGCGAATATCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017992.2-682s21c1
Sequence:CCGGCTGACAGAGCGAGGCTATAACCTCGAGGTTATAGCCTCGCTCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017992.2-725s21c1
Sequence:CCGGAGATTGTGCGAGATGTCAAAGCTCGAGCTTTGACATCTCGCACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks