EMAIL THIS PAGE TO A FRIEND

ACTC1

actin, alpha, cardiac muscle 1

86 Gene Product Result for
Synonyms: ACTC ASD5 CMD1R CMH11 LVNC4
UniProtKB ID: P68032, P04270
Gene ID:
Human(70) Summary: Actins are highly conserved proteins that are involved in various types of cell motility. Polymerization of globular actin (G-actin) leads to a structural filament (F-actin) in the form of a two-stranded helix. Each actin can bind to four others. The protein encoded by this gene belongs to the actin family which is comprised of three main groups of actin isoforms, alpha, beta, and gamma. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. Defects in this gene have been associated with idiopathic dilated cardiomyopathy (IDC) and familial hypertrophic cardiomyopathy (FHC). [provided by RefSeq, Jul 2008]
Mouse(11464) actin, alpha, cardiac muscle 1
Rat(29275) actin, alpha, cardiac muscle 1
chicken(423298) actin, alpha, cardiac muscle 1
cow(533219) actin, alpha, cardiac muscle 1
Horse(100057678) actin, alpha, cardiac muscle 1
domestic cat(101095586) actin, alpha, cardiac muscle 1
dog(478250) actin, alpha, cardiac muscle 1
sheep(101111554) actin, alpha, cardiac muscle 1
Domestic Rabbit(100340339) actin, alpha, cardiac muscle 1
domestic guinea pig(100731953) actin, alpha, cardiac muscle 1
naked mole-rat(101723544) actin, alpha, cardiac muscle 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700789 Anti-Actc1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
A9357 Anti-Actin, Cardiac antibody, Mouse monoclonal clone AC1-20.4.2, purified from hybridoma cell culture bovine, mouse, human, chicken, rat
ELISA, immunocytochemistry, immunohistochemistry, western blot pricing
A2103 Anti-Actin, N-terminal antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, frog, human, chicken, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
A2172 Monoclonal Anti-Actin (α-Sarcomeric) antibody produced in mouse clone 5C5, ascites fluid sheep, snake, human, rabbit, guinea pig, rat, frog, bovine, carp
ELISA, immunohistochemistry, western blot pricing
A3853 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunocytochemistry, immunohistochemistry, microarray, western blot pricing
A4700 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, ascites fluid goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C5838 Monoclonal Anti-Actin–Cy3 antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing
F3046 Monoclonal Anti-Actin–FITC antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0120 AQUA Peptide AVFPSIVG[R] chicken, dog, honey bee, human, mouse, pig, rat pricing
AQ0421 AQUA Peptide IWHHTFYNEL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005159 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005159 Rosetta Predictions human pricing
NM_019183 Rosetta Predictions rat pricing
NM_009608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073006 predicted 1135
2 SASI_Hs02_00339100 predicted 1474
3 SASI_Hs02_00339101 predicted 1414
4 SASI_Hs01_00073007 predicted 979
5 SASI_Hs01_00073008 predicted 657
6 SASI_Hs01_00073009 predicted 1179
7 SASI_Hs01_00073011 predicted 1162
8 SASI_Hs01_00073012 predicted 844
9 SASI_Hs01_00073013 predicted 1099
10 SASI_Hs01_00073014 predicted 1069
11 SASI_Hs01_00073005 predicted 801
12 SASI_Hs01_00073010 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097819 predicted 812
2 SASI_Rn01_00097820 predicted 840
3 SASI_Rn01_00097822 predicted 352
4 SASI_Rn01_00097823 predicted 984
5 SASI_Rn01_00097824 predicted 842
6 SASI_Rn01_00097825 predicted 1018
7 SASI_Rn02_00261988 predicted 343
8 SASI_Rn02_00261989 predicted 208
9 SASI_Rn02_00261990 predicted 1014
10 SASI_Rn02_00261991 predicted 692
11 SASI_Rn01_00097817 predicted 1035
12 SASI_Rn01_00097818 predicted 757
13 SASI_Rn01_00097821 predicted 1015
14 SASI_Rn01_00097826 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171005 predicted 891
2 SASI_Mm01_00171006 predicted 901
3 SASI_Mm02_00316536 predicted 541
4 SASI_Mm02_00316537 predicted 560
5 SASI_Mm01_00171008 predicted 927
6 SASI_Mm02_00316538 predicted 329
7 SASI_Mm01_00171010 predicted 1002
8 SASI_Mm01_00171011 predicted 1084
9 SASI_Mm01_00171012 predicted 577
10 SASI_Mm01_00171013 predicted 671
11 SASI_Mm01_00171004 predicted 879
12 SASI_Mm01_00171007 predicted 737
13 SASI_Mm01_00171009 predicted 604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005159
ACTC1 MISSION shRNA Bacterial Glycerol Stock
actin, alpha, cardiac muscle 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005159.4-1070s21c1
Sequence:CCGGTCCATGAAACAACTTACAATACTCGAGTATTGTAAGTTGTTTCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005159.4-1675s21c1
Sequence:CCGGACAGTTAGCTGGGAGTTATAACTCGAGTTATAACTCCCAGCTAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005159.4-1543s21c1
Sequence:CCGGCCAGGACTTGCAACCTATAAACTCGAGTTTATAGGTTGCAAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-799s1c1
Sequence:CCGGCGTGAAATTGTCCGTGACATTCTCGAGAATGTCACGGACAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005159.3-1337s1c1
Sequence:CCGGCCAGTCAGGATGACGGTATTACTCGAGTAATACCGTCATCCTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-1101s1c1
Sequence:CCGGCCCTGGTATTGCTGATCGTATCTCGAGATACGATCAGCAATACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-1100s1c1
Sequence:CCGGACCCTGGTATTGCTGATCGTACTCGAGTACGATCAGCAATACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-973s1c1
Sequence:CCGGCCCTCCTTCATTGGTATGGAACTCGAGTTCCATACCAATGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005159
ACTC1 MISSION shRNA shRNA Plasmid DNA
actin, alpha, cardiac muscle 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005159.4-1070s21c1
Sequence:CCGGTCCATGAAACAACTTACAATACTCGAGTATTGTAAGTTGTTTCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005159.4-1675s21c1
Sequence:CCGGACAGTTAGCTGGGAGTTATAACTCGAGTTATAACTCCCAGCTAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005159.4-1543s21c1
Sequence:CCGGCCAGGACTTGCAACCTATAAACTCGAGTTTATAGGTTGCAAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-799s1c1
Sequence:CCGGCGTGAAATTGTCCGTGACATTCTCGAGAATGTCACGGACAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005159.3-1337s1c1
Sequence:CCGGCCAGTCAGGATGACGGTATTACTCGAGTAATACCGTCATCCTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-1101s1c1
Sequence:CCGGCCCTGGTATTGCTGATCGTATCTCGAGATACGATCAGCAATACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-1100s1c1
Sequence:CCGGACCCTGGTATTGCTGATCGTACTCGAGTACGATCAGCAATACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-973s1c1
Sequence:CCGGCCCTCCTTCATTGGTATGGAACTCGAGTTCCATACCAATGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005159
ACTC1 MISSION shRNA Lentiviral Transduction Particles
actin, alpha, cardiac muscle 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005159.4-1070s21c1
Sequence:CCGGTCCATGAAACAACTTACAATACTCGAGTATTGTAAGTTGTTTCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005159.4-1675s21c1
Sequence:CCGGACAGTTAGCTGGGAGTTATAACTCGAGTTATAACTCCCAGCTAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005159.4-1543s21c1
Sequence:CCGGCCAGGACTTGCAACCTATAAACTCGAGTTTATAGGTTGCAAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-799s1c1
Sequence:CCGGCGTGAAATTGTCCGTGACATTCTCGAGAATGTCACGGACAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005159.3-1337s1c1
Sequence:CCGGCCAGTCAGGATGACGGTATTACTCGAGTAATACCGTCATCCTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-1101s1c1
Sequence:CCGGCCCTGGTATTGCTGATCGTATCTCGAGATACGATCAGCAATACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-1100s1c1
Sequence:CCGGACCCTGGTATTGCTGATCGTACTCGAGTACGATCAGCAATACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005159.3-973s1c1
Sequence:CCGGCCCTCCTTCATTGGTATGGAACTCGAGTTCCATACCAATGAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009608
ACTC1 MISSION shRNA Bacterial Glycerol Stock
actin, alpha, cardiac muscle 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-1089s1c1
Sequence:CCGGCGTAAATACTCTGTCTGGATTCTCGAGAATCCAGACAGAGTATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-554s1c1
Sequence:CCGGCGATGGTGTAACTCATAATGTCTCGAGACATTATGAGTTACACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-555s1c1
Sequence:CCGGGATGGTGTAACTCATAATGTTCTCGAGAACATTATGAGTTACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009608.1-1219s1c1
Sequence:CCGGTCTCTCTCTTAGCCTACCTTACTCGAGTAAGGTAGGCTAAGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-702s1c1
Sequence:CCGGCGTGAAATTGTCCGTGACATACTCGAGTATGTCACGGACAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009608
ACTC1 MISSION shRNA shRNA Plasmid DNA
actin, alpha, cardiac muscle 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-1089s1c1
Sequence:CCGGCGTAAATACTCTGTCTGGATTCTCGAGAATCCAGACAGAGTATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-554s1c1
Sequence:CCGGCGATGGTGTAACTCATAATGTCTCGAGACATTATGAGTTACACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-555s1c1
Sequence:CCGGGATGGTGTAACTCATAATGTTCTCGAGAACATTATGAGTTACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009608.1-1219s1c1
Sequence:CCGGTCTCTCTCTTAGCCTACCTTACTCGAGTAAGGTAGGCTAAGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-702s1c1
Sequence:CCGGCGTGAAATTGTCCGTGACATACTCGAGTATGTCACGGACAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009608
ACTC1 MISSION shRNA Lentiviral Transduction Particles
actin, alpha, cardiac muscle 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-1089s1c1
Sequence:CCGGCGTAAATACTCTGTCTGGATTCTCGAGAATCCAGACAGAGTATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-554s1c1
Sequence:CCGGCGATGGTGTAACTCATAATGTCTCGAGACATTATGAGTTACACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-555s1c1
Sequence:CCGGGATGGTGTAACTCATAATGTTCTCGAGAACATTATGAGTTACACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009608.1-1219s1c1
Sequence:CCGGTCTCTCTCTTAGCCTACCTTACTCGAGTAAGGTAGGCTAAGAGAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009608.1-702s1c1
Sequence:CCGGCGTGAAATTGTCCGTGACATACTCGAGTATGTCACGGACAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks