EMAIL THIS PAGE TO A FRIEND

ACTG1

actin, gamma 1

Synonyms: ACT ACTG BRWS2 DFNA20 DFNA26
Gene ID:
Human(71) Summary: Actins are highly conserved proteins that are involved in various types of cell motility, and maintenance of the cytoskeleton. In vertebrates, three main groups of actin isoforms, alpha, beta and gamma have been identified. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton, and as mediators of internal cell motility. Actin, gamma 1, encoded by this gene, is a cytoplasmic actin found in non-muscle cells. Mutations in this gene are associated with DFNA20/26, a subtype of autosomal dominant non-syndromic sensorineural progressive hearing loss. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]
Mouse(11465) actin, gamma, cytoplasmic 1
Rat(287876) actin, gamma 1
naked mole-rat(101702483) actin, gamma 1
chicken(415296) Actin, gamma 1
dog(475923) actin, gamma 1
cow(404122) actin, gamma 1
Horse(100050139) actin, gamma 1
dog(442937) actin, gamma 1
Gene Class: Cytoskeleton
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A2103 Anti-Actin, N-terminal antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, frog, human, chicken, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
WH0000071M1 Monoclonal Anti-ACTG1 antibody produced in mouse clone 1G6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
A3853 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunocytochemistry, immunohistochemistry, microarray, western blot pricing
A4700 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, ascites fluid goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C5838 Monoclonal Anti-Actin–Cy3 antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing
F3046 Monoclonal Anti-Actin–FITC antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing
A8481 Monoclonal Anti-γ-Actin antibody produced in mouse ~2 mg/mL, clone 2-2.1.14.17, purified immunoglobulin, buffered aqueous solution canine, human, bovine, mouse, hamster, chicken
ELISA, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0120 AQUA Peptide AVFPSIVG[R] chicken, dog, honey bee, human, mouse, pig, rat pricing
AQ0421 AQUA Peptide IWHHTFYNEL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001614 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001614 Rosetta Predictions human pricing
NM_001127449 Rosetta Predictions rat pricing
XM_213540 Rosetta Predictions rat pricing
NM_009609 Rosetta Predictions mouse pricing
NM_013798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137541 predicted 1469
2 SASI_Hs01_00137542 predicted 1233
3 SASI_Hs01_00137544 predicted 1483
4 SASI_Hs01_00137545 predicted 1218
5 SASI_Hs01_00137547 predicted 1217
6 SASI_Hs01_00137548 predicted 1425
7 SASI_Hs02_00332170 predicted 1445
8 SASI_Hs01_00137549 predicted 1342
9 SASI_Hs01_00137550 predicted 1227
10 SASI_Hs02_00332171 predicted 768
11 SASI_Hs01_00137543 predicted 1186
12 SASI_Hs01_00137546 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127449 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253753 predicted 276
2 SASI_Rn02_00253754 predicted 212
3 SASI_Rn02_00253755 predicted 274
4 SASI_Rn02_00253756 predicted 681
5 SASI_Rn02_00253757 predicted 1231
6 SASI_Rn02_00253758 predicted 669
7 SASI_Rn02_00253759 predicted 1185
8 SASI_Rn02_00253760 predicted 688
9 SASI_Rn02_00253761 predicted 719
10 SASI_Rn02_00253762 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162541 predicted 681
2 SASI_Rn01_00162542 predicted 1230
3 SASI_Rn01_00162543 predicted 661
4 SASI_Rn01_00162544 predicted 406
5 SASI_Rn01_00162545 predicted 416
6 SASI_Rn01_00162546 predicted 682
7 SASI_Rn01_00162547 predicted 274
8 SASI_Rn01_00162548 predicted 214
9 SASI_Rn01_00162549 predicted 267
10 SASI_Rn01_00162550 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033096 predicted 877
2 SASI_Mm02_00316539 predicted 733
3 SASI_Mm02_00316540 predicted 1228
4 SASI_Mm02_00316541 predicted 917
5 SASI_Mm02_00316542 predicted 273
6 SASI_Mm01_00033089 predicted 1029
7 SASI_Mm01_00033092 predicted 1288
8 SASI_Mm02_00316543 predicted 1237
9 SASI_Mm01_00033094 predicted 1221
10 SASI_Mm02_00316544 predicted 70
11 SASI_Mm01_00033088 predicted 686
12 SASI_Mm01_00033090 predicted 667
13 SASI_Mm01_00033091 predicted 896
14 SASI_Mm01_00033093 predicted 1184
15 SASI_Mm01_00033095 predicted 431
16 SASI_Mm01_00033097 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103433 predicted 717
2 SASI_Mm01_00103434 predicted 1264
3 SASI_Mm01_00103435 predicted 1064
4 SASI_Mm01_00103436 predicted 696
5 SASI_Mm01_00103437 predicted 928
6 SASI_Mm01_00103438 predicted 1321
7 SASI_Mm01_00103439 predicted 1214
8 SASI_Mm01_00103440 predicted 454
9 SASI_Mm01_00103441 predicted 909
10 SASI_Mm01_00103442 predicted 1267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009609
VALIDATED
ACTG1 MISSION shRNA Bacterial Glycerol Stock
actin, gamma 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009609.2-1421s1c1
Sequence:CCGGCCCTGTGCATATCTTGATTTACTCGAGTAAATCAAGATATGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009609.2-894s1c1
Sequence:CCGGGACCACTTTCAACTCCATCATCTCGAGATGATGGAGTTGAAAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009609.2-935s1c1
Sequence:CCGGGCAAAGACCTGTATGCCAATACTCGAGTATTGGCATACAGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009609.2-279s1c1
Sequence:CCGGCGAACACGGCATTGTCACTAACTCGAGTTAGTGACAATGCCGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009609.2-1035s1c1
Sequence:CCGGCACGATGAAGATTAAGATCATCTCGAGATGATCTTAATCTTCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009609.2-414s21c1
Sequence:CCGGAGAGAAGATGACGCAGATAATCTCGAGATTATCTGCGTCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009609.2-935s21c1
Sequence:CCGGGCAAAGACCTGTATGCCAATACTCGAGTATTGGCATACAGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009609.2-1035s21c1
Sequence:CCGGCACGATGAAGATTAAGATCATCTCGAGATGATCTTAATCTTCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009609.2-1421s21c1
Sequence:CCGGCCCTGTGCATATCTTGATTTACTCGAGTAAATCAAGATATGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009609
VALIDATED
ACTG1 MISSION shRNA shRNA Plasmid DNA
actin, gamma 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009609.2-1421s1c1
Sequence:CCGGCCCTGTGCATATCTTGATTTACTCGAGTAAATCAAGATATGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009609.2-894s1c1
Sequence:CCGGGACCACTTTCAACTCCATCATCTCGAGATGATGGAGTTGAAAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009609.2-935s1c1
Sequence:CCGGGCAAAGACCTGTATGCCAATACTCGAGTATTGGCATACAGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009609.2-279s1c1
Sequence:CCGGCGAACACGGCATTGTCACTAACTCGAGTTAGTGACAATGCCGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009609.2-1035s1c1
Sequence:CCGGCACGATGAAGATTAAGATCATCTCGAGATGATCTTAATCTTCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009609.2-414s21c1
Sequence:CCGGAGAGAAGATGACGCAGATAATCTCGAGATTATCTGCGTCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009609.2-935s21c1
Sequence:CCGGGCAAAGACCTGTATGCCAATACTCGAGTATTGGCATACAGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009609.2-1035s21c1
Sequence:CCGGCACGATGAAGATTAAGATCATCTCGAGATGATCTTAATCTTCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009609.2-1421s21c1
Sequence:CCGGCCCTGTGCATATCTTGATTTACTCGAGTAAATCAAGATATGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009609
VALIDATED
ACTG1 MISSION shRNA Lentiviral Transduction Particles
actin, gamma 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009609.2-1421s1c1
Sequence:CCGGCCCTGTGCATATCTTGATTTACTCGAGTAAATCAAGATATGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009609.2-894s1c1
Sequence:CCGGGACCACTTTCAACTCCATCATCTCGAGATGATGGAGTTGAAAGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009609.2-935s1c1
Sequence:CCGGGCAAAGACCTGTATGCCAATACTCGAGTATTGGCATACAGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009609.2-279s1c1
Sequence:CCGGCGAACACGGCATTGTCACTAACTCGAGTTAGTGACAATGCCGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009609.2-1035s1c1
Sequence:CCGGCACGATGAAGATTAAGATCATCTCGAGATGATCTTAATCTTCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009609.2-414s21c1
Sequence:CCGGAGAGAAGATGACGCAGATAATCTCGAGATTATCTGCGTCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009609.2-935s21c1
Sequence:CCGGGCAAAGACCTGTATGCCAATACTCGAGTATTGGCATACAGGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009609.2-1035s21c1
Sequence:CCGGCACGATGAAGATTAAGATCATCTCGAGATGATCTTAATCTTCATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009609.2-1421s21c1
Sequence:CCGGCCCTGTGCATATCTTGATTTACTCGAGTAAATCAAGATATGCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001614
VALIDATED
ACTG1 MISSION shRNA Bacterial Glycerol Stock
actin, gamma 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-1607s1c1
Sequence:CCGGGCTGGCAAGAACCAGTTGTTTCTCGAGAAACAACTGGTTCTTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-257s1c1
Sequence:CCGGGCGTGGCATCCTGACCCTGAACTCGAGTTCAGGGTCAGGATGCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-764s1c1
Sequence:CCGGCGCATCCTCCTCTTCTCTGGACTCGAGTCCAGAGAAGAGGAGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001614.2-1130s1c1
Sequence:CCGGCCAGCAGATGTGGATTAGCAACTCGAGTTGCTAATCCACATCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-155s1c1
Sequence:CCGGCCGAGCCGTGTTTCCTTCCATCTCGAGATGGAAGGAAACACGGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001614.2-155s21c1
Sequence:CCGGCCGAGCCGTGTTTCCTTCCATCTCGAGATGGAAGGAAACACGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001614.2-522s21c1
Sequence:CCGGGGCATTGTCATGGACTCTGGACTCGAGTCCAGAGTCCATGACAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001614.2-1607s21c1
Sequence:CCGGGCTGGCAAGAACCAGTTGTTTCTCGAGAAACAACTGGTTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001614.2-1198s21c1
Sequence:CCGGTCTAAACGGACTCAGCAGATGCTCGAGCATCTGCTGAGTCCGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001614
VALIDATED
ACTG1 MISSION shRNA shRNA Plasmid DNA
actin, gamma 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-1607s1c1
Sequence:CCGGGCTGGCAAGAACCAGTTGTTTCTCGAGAAACAACTGGTTCTTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-257s1c1
Sequence:CCGGGCGTGGCATCCTGACCCTGAACTCGAGTTCAGGGTCAGGATGCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-764s1c1
Sequence:CCGGCGCATCCTCCTCTTCTCTGGACTCGAGTCCAGAGAAGAGGAGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001614.2-1130s1c1
Sequence:CCGGCCAGCAGATGTGGATTAGCAACTCGAGTTGCTAATCCACATCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-155s1c1
Sequence:CCGGCCGAGCCGTGTTTCCTTCCATCTCGAGATGGAAGGAAACACGGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001614.2-155s21c1
Sequence:CCGGCCGAGCCGTGTTTCCTTCCATCTCGAGATGGAAGGAAACACGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001614.2-522s21c1
Sequence:CCGGGGCATTGTCATGGACTCTGGACTCGAGTCCAGAGTCCATGACAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001614.2-1607s21c1
Sequence:CCGGGCTGGCAAGAACCAGTTGTTTCTCGAGAAACAACTGGTTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001614.2-1198s21c1
Sequence:CCGGTCTAAACGGACTCAGCAGATGCTCGAGCATCTGCTGAGTCCGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001614
VALIDATED
ACTG1 MISSION shRNA Lentiviral Transduction Particles
actin, gamma 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-1607s1c1
Sequence:CCGGGCTGGCAAGAACCAGTTGTTTCTCGAGAAACAACTGGTTCTTGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-257s1c1
Sequence:CCGGGCGTGGCATCCTGACCCTGAACTCGAGTTCAGGGTCAGGATGCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-764s1c1
Sequence:CCGGCGCATCCTCCTCTTCTCTGGACTCGAGTCCAGAGAAGAGGAGGATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001614.2-1130s1c1
Sequence:CCGGCCAGCAGATGTGGATTAGCAACTCGAGTTGCTAATCCACATCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001614.2-155s1c1
Sequence:CCGGCCGAGCCGTGTTTCCTTCCATCTCGAGATGGAAGGAAACACGGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001614.2-155s21c1
Sequence:CCGGCCGAGCCGTGTTTCCTTCCATCTCGAGATGGAAGGAAACACGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001614.2-522s21c1
Sequence:CCGGGGCATTGTCATGGACTCTGGACTCGAGTCCAGAGTCCATGACAATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001614.2-1607s21c1
Sequence:CCGGGCTGGCAAGAACCAGTTGTTTCTCGAGAAACAACTGGTTCTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001614.2-1198s21c1
Sequence:CCGGTCTAAACGGACTCAGCAGATGCTCGAGCATCTGCTGAGTCCGTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks