EMAIL THIS PAGE TO A FRIEND

ACTG2

actin, gamma 2, smooth muscle, enteric

48 Gene Product Result for
Synonyms: ACT ACTA3 ACTE ACTL3 ACTSG
Gene ID:
Human(72) Summary: Actins are highly conserved proteins that are involved in various types of cell motility and in the maintenance of the cytoskeleton. Three types of actins, alpha, beta and gamma, have been identified in vertebrates. Alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. This gene encodes actin gamma 2; a smooth muscle actin found in enteric tissues. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Based on similarity to peptide cleavage of related actins, the mature protein of this gene is formed by removal of two N-terminal peptides.[provided by RefSeq, Dec 2010]
Mouse(11468) actin, gamma 2, smooth muscle, enteric
Rat(25365) actin, gamma 2, smooth muscle, enteric
chicken(396084) actin, gamma 2, smooth muscle, enteric
domestic cat(101082743) actin, gamma 2, smooth muscle, enteric
Horse(100057561) actin, gamma 2, smooth muscle, enteric
cow(281595) actin, gamma 2, smooth muscle, enteric
dog(475792) actin, gamma 2, smooth muscle, enteric
domestic guinea pig(100716255) actin, gamma 2, smooth muscle, enteric
naked mole-rat(101711134) actin, gamma 2, smooth muscle, enteric
sheep(101114256) actin, gamma 2, smooth muscle, enteric
Domestic Rabbit(100350318) actin, gamma 2, smooth muscle, enteric
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411364 Anti-ACTG2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
A2103 Anti-Actin, N-terminal antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, frog, human, chicken, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503033 Anti-Actin-γ2, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
A3853 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunocytochemistry, immunohistochemistry, microarray, western blot pricing
A4700 Monoclonal Anti-Actin antibody produced in mouse clone AC-40, ascites fluid goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C5838 Monoclonal Anti-Actin–Cy3 antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing
F3046 Monoclonal Anti-Actin–FITC antibody produced in mouse clone AC-40, purified immunoglobulin, buffered aqueous solution goat, viper, Xenopus, bovine, guinea pig, snail, canine, hamster, rat, chicken, mouse, human, sheep, pig, rabbit, carp
immunofluorescence pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0120 AQUA Peptide AVFPSIVG[R] chicken, dog, honey bee, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001615 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084921 MISSION® esiRNA esiRNA human ACTG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001615 Rosetta Predictions human pricing
NM_012893 Rosetta Predictions rat pricing
NM_009610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174887 predicted 977
2 SASI_Hs01_00174888 predicted 924
3 SASI_Hs01_00174889 predicted 709
4 SASI_Hs01_00174890 predicted 586
5 SASI_Hs01_00174891 predicted 704
6 SASI_Hs01_00174892 predicted 988
7 SASI_Hs02_00332172 predicted 941
8 SASI_Hs02_00332173 predicted 904
9 SASI_Hs01_00174893 predicted 298
10 SASI_Hs01_00174895 predicted 571
11 SASI_Hs01_00174886 predicted 590
12 SASI_Hs01_00174894 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093659 predicted 370
2 SASI_Rn01_00093660 predicted 835
3 SASI_Rn01_00093661 predicted 629
4 SASI_Rn01_00093662 predicted 867
5 SASI_Rn01_00093663 predicted 407
6 SASI_Rn01_00093664 predicted 408
7 SASI_Rn01_00093665 predicted 837
8 SASI_Rn01_00093666 predicted 382
9 SASI_Rn01_00093667 predicted 873
10 SASI_Rn01_00093668 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055927 predicted 728
2 SASI_Mm01_00055928 predicted 970
3 SASI_Mm01_00055929 predicted 727
4 SASI_Mm01_00055930 predicted 466
5 SASI_Mm01_00055931 predicted 300
6 SASI_Mm01_00055932 predicted 298
7 SASI_Mm01_00055933 predicted 922
8 SASI_Mm01_00055935 predicted 374
9 SASI_Mm01_00055934 predicted 928
10 SASI_Mm02_00316545 predicted 1216
11 SASI_Mm01_00055926 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001615
ACTG2 MISSION shRNA Bacterial Glycerol Stock
actin, gamma 2, smooth muscle, enteric
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001615.3-702s21c1
Sequence:CCGGCTCACAGAGAGAGGCTATTCCCTCGAGGGAATAGCCTCTCTCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001615.3-1191s21c1
Sequence:CCGGTGGATCAGCAAGCCTGAGTATCTCGAGATACTCAGGCTTGCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-992s1c1
Sequence:CCGGCCGTAAGGACTTATATGCCAACTCGAGTTGGCATATAAGTCCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-860s1c1
Sequence:CCGGGCAGGTTATCACCATTGGCAACTCGAGTTGCCAATGGTGATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-568s1c1
Sequence:CCGGCGACAGGCATCGTCCTGGATTCTCGAGAATCCAGGACGATGCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-740s1c1
Sequence:CCGGGAGAGAAATTGTGCGAGACATCTCGAGATGTCTCGCACAATTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-309s1c1
Sequence:CCGGCGAGGGATCCTAACTCTCAAACTCGAGTTTGAGAGTTAGGATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001615
ACTG2 MISSION shRNA shRNA Plasmid DNA
actin, gamma 2, smooth muscle, enteric
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001615.3-702s21c1
Sequence:CCGGCTCACAGAGAGAGGCTATTCCCTCGAGGGAATAGCCTCTCTCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001615.3-1191s21c1
Sequence:CCGGTGGATCAGCAAGCCTGAGTATCTCGAGATACTCAGGCTTGCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-992s1c1
Sequence:CCGGCCGTAAGGACTTATATGCCAACTCGAGTTGGCATATAAGTCCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-860s1c1
Sequence:CCGGGCAGGTTATCACCATTGGCAACTCGAGTTGCCAATGGTGATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-568s1c1
Sequence:CCGGCGACAGGCATCGTCCTGGATTCTCGAGAATCCAGGACGATGCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-740s1c1
Sequence:CCGGGAGAGAAATTGTGCGAGACATCTCGAGATGTCTCGCACAATTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-309s1c1
Sequence:CCGGCGAGGGATCCTAACTCTCAAACTCGAGTTTGAGAGTTAGGATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001615
ACTG2 MISSION shRNA Lentiviral Transduction Particles
actin, gamma 2, smooth muscle, enteric
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001615.3-702s21c1
Sequence:CCGGCTCACAGAGAGAGGCTATTCCCTCGAGGGAATAGCCTCTCTCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001615.3-1191s21c1
Sequence:CCGGTGGATCAGCAAGCCTGAGTATCTCGAGATACTCAGGCTTGCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-992s1c1
Sequence:CCGGCCGTAAGGACTTATATGCCAACTCGAGTTGGCATATAAGTCCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-860s1c1
Sequence:CCGGGCAGGTTATCACCATTGGCAACTCGAGTTGCCAATGGTGATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-568s1c1
Sequence:CCGGCGACAGGCATCGTCCTGGATTCTCGAGAATCCAGGACGATGCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-740s1c1
Sequence:CCGGGAGAGAAATTGTGCGAGACATCTCGAGATGTCTCGCACAATTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001615.3-309s1c1
Sequence:CCGGCGAGGGATCCTAACTCTCAAACTCGAGTTTGAGAGTTAGGATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009610
VALIDATED
ACTG2 MISSION shRNA Bacterial Glycerol Stock
actin, gamma 2, smooth muscle, enteric
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-721s21c1
Sequence:CCGGGCTGAGAGAGAAATTGTACGACTCGAGTCGTACAATTTCTCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-304s21c1
Sequence:CCGGCTAACTCTCAAGTACCCTATTCTCGAGAATAGGGTACTTGAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-978s21c1
Sequence:CCGGCCGCAAAGATTTGTATGCTAACTCGAGTTAGCATACAAATCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-499s21c1
Sequence:CCGGCCTGCCATGTATGTTGCTATTCTCGAGAATAGCAACATACATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-916s1c1
Sequence:CCGGCCGCAAAGATTTGTATGCTAACTCGAGTTAGCATACAAATCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-242s1c1
Sequence:CCGGCTAACTCTCAAGTACCCTATTCTCGAGAATAGGGTACTTGAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009610.1-667s1c1
Sequence:CCGGAGAAATTGTACGAGACATCAACTCGAGTTGATGTCTCGTACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-659s1c1
Sequence:CCGGGCTGAGAGAGAAATTGTACGACTCGAGTCGTACAATTTCTCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-437s1c1
Sequence:CCGGCCTGCCATGTATGTTGCTATTCTCGAGAATAGCAACATACATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009610
VALIDATED
ACTG2 MISSION shRNA shRNA Plasmid DNA
actin, gamma 2, smooth muscle, enteric
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-721s21c1
Sequence:CCGGGCTGAGAGAGAAATTGTACGACTCGAGTCGTACAATTTCTCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-304s21c1
Sequence:CCGGCTAACTCTCAAGTACCCTATTCTCGAGAATAGGGTACTTGAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-978s21c1
Sequence:CCGGCCGCAAAGATTTGTATGCTAACTCGAGTTAGCATACAAATCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-499s21c1
Sequence:CCGGCCTGCCATGTATGTTGCTATTCTCGAGAATAGCAACATACATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-916s1c1
Sequence:CCGGCCGCAAAGATTTGTATGCTAACTCGAGTTAGCATACAAATCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-242s1c1
Sequence:CCGGCTAACTCTCAAGTACCCTATTCTCGAGAATAGGGTACTTGAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009610.1-667s1c1
Sequence:CCGGAGAAATTGTACGAGACATCAACTCGAGTTGATGTCTCGTACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-659s1c1
Sequence:CCGGGCTGAGAGAGAAATTGTACGACTCGAGTCGTACAATTTCTCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-437s1c1
Sequence:CCGGCCTGCCATGTATGTTGCTATTCTCGAGAATAGCAACATACATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009610
VALIDATED
ACTG2 MISSION shRNA Lentiviral Transduction Particles
actin, gamma 2, smooth muscle, enteric
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-721s21c1
Sequence:CCGGGCTGAGAGAGAAATTGTACGACTCGAGTCGTACAATTTCTCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-304s21c1
Sequence:CCGGCTAACTCTCAAGTACCCTATTCTCGAGAATAGGGTACTTGAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-978s21c1
Sequence:CCGGCCGCAAAGATTTGTATGCTAACTCGAGTTAGCATACAAATCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009610.2-499s21c1
Sequence:CCGGCCTGCCATGTATGTTGCTATTCTCGAGAATAGCAACATACATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-916s1c1
Sequence:CCGGCCGCAAAGATTTGTATGCTAACTCGAGTTAGCATACAAATCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-242s1c1
Sequence:CCGGCTAACTCTCAAGTACCCTATTCTCGAGAATAGGGTACTTGAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009610.1-667s1c1
Sequence:CCGGAGAAATTGTACGAGACATCAACTCGAGTTGATGTCTCGTACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-659s1c1
Sequence:CCGGGCTGAGAGAGAAATTGTACGACTCGAGTCGTACAATTTCTCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009610.1-437s1c1
Sequence:CCGGCCTGCCATGTATGTTGCTATTCTCGAGAATAGCAACATACATGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks