EMAIL THIS PAGE TO A FRIEND

ACTL10

actin-like 10

24 Gene Product Result for
Synonyms: C20orf134 dJ63M2.2
UniProtKB ID: Q5JWF8, B9EH76
Gene ID:
Mouse(70362) actin-like 10
Rat(100911682) actin-like 10
cow(101902179) actin-like 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024675 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024675 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071703 predicted 1244
2 SASI_Hs02_00307236 predicted 1473
3 SASI_Hs01_00071704 predicted 1215
4 SASI_Hs01_00071705 predicted 1336
5 SASI_Hs01_00071706 predicted 1214
6 SASI_Hs01_00071707 predicted 1301
7 SASI_Hs01_00071708 predicted 1115
8 SASI_Hs01_00071710 predicted 1127
9 SASI_Hs01_00071711 predicted 1136
10 SASI_Hs02_00307237 predicted 1486
11 SASI_Hs01_00071709 predicted 1184
12 SASI_Hs01_00071712 predicted 1185
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024675
ACTL10 MISSION shRNA Bacterial Glycerol Stock
actin-like 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1310s21c1
Sequence:CCGGGCCAGTTTCAGCGTGGGTAACCTCGAGGTTACCCACGCTGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1676s21c1
Sequence:CCGGTGGATAACTCGGGCCATGTACCTCGAGGTACATGGCCCGAGTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024675.1-1774s21c1
Sequence:CCGGGGGACAGCTCTCTATCTAAAGCTCGAGCTTTAGATAGAGAGCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1222s21c1
Sequence:CCGGCAAGGCCATCACACATCTCAACTCGAGTTGAGATGTGTGATGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1719s21c1
Sequence:CCGGTGTACGATGTGTTCAACTGAGCTCGAGCTCAGTTGAACACATCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024675
ACTL10 MISSION shRNA shRNA Plasmid DNA
actin-like 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1310s21c1
Sequence:CCGGGCCAGTTTCAGCGTGGGTAACCTCGAGGTTACCCACGCTGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1676s21c1
Sequence:CCGGTGGATAACTCGGGCCATGTACCTCGAGGTACATGGCCCGAGTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024675.1-1774s21c1
Sequence:CCGGGGGACAGCTCTCTATCTAAAGCTCGAGCTTTAGATAGAGAGCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1222s21c1
Sequence:CCGGCAAGGCCATCACACATCTCAACTCGAGTTGAGATGTGTGATGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1719s21c1
Sequence:CCGGTGTACGATGTGTTCAACTGAGCTCGAGCTCAGTTGAACACATCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024675
ACTL10 MISSION shRNA Lentiviral Transduction Particles
actin-like 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1310s21c1
Sequence:CCGGGCCAGTTTCAGCGTGGGTAACCTCGAGGTTACCCACGCTGAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1676s21c1
Sequence:CCGGTGGATAACTCGGGCCATGTACCTCGAGGTACATGGCCCGAGTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024675.1-1774s21c1
Sequence:CCGGGGGACAGCTCTCTATCTAAAGCTCGAGCTTTAGATAGAGAGCTGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1222s21c1
Sequence:CCGGCAAGGCCATCACACATCTCAACTCGAGTTGAGATGTGTGATGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024675.1-1719s21c1
Sequence:CCGGTGTACGATGTGTTCAACTGAGCTCGAGCTCAGTTGAACACATCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks