EMAIL THIS PAGE TO A FRIEND

ACTL6A

actin-like 6A

113 Gene Product Result for
Synonyms: ACTL6 ARPN-BETA Arp4 BAF53A INO80K
UniProtKB ID: O96019, B3KMN1, D3DNR9, Q8TAE5, Q9BVS8, Q9H0W6
Gene ID:
Human(86) Summary: This gene encodes a family member of actin-related proteins (ARPs), which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a 53 kDa subunit protein of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. Together with beta-actin, it is required for maximal ATPase activity of BRG1, and for the association of the BAF complex with chromatin/matrix. Three transcript variants that encode two different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(56456) actin-like 6A
Rat(361925) actin-like 6A
sheep(101108709) actin-like 6A
Zebrafish(192313) actin-like 6A
chicken(424975) actin-like 6A
cow(100125416) actin-like 6A
Horse(100065792) actin-like 6A
domestic cat(101091095) actin-like 6A
dog(478637) actin-like 6A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019673 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019673 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019673 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177989 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132371 MISSION® esiRNA esiRNA human ACTL6A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004301 Rosetta Predictions human pricing
NM_177989 Rosetta Predictions human pricing
NM_178042 Rosetta Predictions human pricing
NM_001039033 Rosetta Predictions rat pricing
NM_019673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337321 predicted 499
2 SASI_Hs01_00104101 predicted 1128
3 SASI_Hs01_00104102 predicted 823
4 SASI_Hs01_00104103 predicted 797
5 SASI_Hs01_00104104 predicted 1498
6 SASI_Hs01_00104105 predicted 1160
7 SASI_Hs01_00104106 predicted 890
8 SASI_Hs01_00104107 predicted 923
9 SASI_Hs01_00104108 predicted 1134
10 SASI_Hs01_00104109 predicted 1450
11 SASI_Hs01_00104110 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369461 predicted 351
2 SASI_Hs01_00092797 predicted 979
3 SASI_Hs01_00092798 predicted 682
4 SASI_Hs01_00092799 predicted 651
5 SASI_Hs01_00092800 predicted 1354
6 SASI_Hs01_00092801 predicted 1015
7 SASI_Hs01_00092802 predicted 747
8 SASI_Hs01_00092803 predicted 779
9 SASI_Hs01_00092804 predicted 985
10 SASI_Hs01_00092805 predicted 1314
11 SASI_Hs01_00092806 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369522 predicted 546
2 SASI_Hs01_00067165 predicted 1170
3 SASI_Hs01_00067166 predicted 874
4 SASI_Hs01_00067167 predicted 842
5 SASI_Hs01_00067168 predicted 1542
6 SASI_Hs01_00067169 predicted 1208
7 SASI_Hs01_00067170 predicted 939
8 SASI_Hs01_00067171 predicted 969
9 SASI_Hs01_00067172 predicted 1180
10 SASI_Hs01_00067173 predicted 1501
11 SASI_Hs01_00067174 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204786 predicted 400
2 SASI_Rn01_00078375 predicted 910
3 SASI_Rn01_00078376 predicted 725
4 SASI_Rn01_00078377 predicted 996
5 SASI_Rn01_00078378 predicted 799
6 SASI_Rn01_00078379 predicted 1015
7 SASI_Rn01_00078381 predicted 715
8 SASI_Rn01_00078382 predicted 560
9 SASI_Rn01_00078383 predicted 465
10 SASI_Rn02_00204787 predicted 1399
11 SASI_Rn01_00078380 predicted 693
12 SASI_Rn01_00078384 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110642 predicted 1306
2 SASI_Mm01_00110643 predicted 444
3 SASI_Mm01_00110644 predicted 443
4 SASI_Mm02_00324741 predicted 1632
5 SASI_Mm02_00324742 predicted 964
6 SASI_Mm01_00110645 predicted 1528
7 SASI_Mm02_00324743 predicted 898
8 SASI_Mm02_00324744 predicted 1485
9 SASI_Mm02_00324745 predicted 1330
10 SASI_Mm02_00324746 predicted 924
11 SASI_Mm01_00110646 predicted 1346
12 SASI_Mm01_00110647 predicted 1066
13 SASI_Mm01_00110648 predicted 605
14 SASI_Mm01_00110649 predicted 931
15 SASI_Mm01_00110650 predicted 1358
16 SASI_Mm01_00110651 predicted 754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019673
VALIDATED
ACTL6A MISSION shRNA Bacterial Glycerol Stock
actin-like 6A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019673.1-1246s1c1
Sequence:CCGGTCCACCAAGTATGCGGTTGAACTCGAGTTCAACCGCATACTTGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019673.1-1591s1c1
Sequence:CCGGGCACTTATCTATACAGGCATTCTCGAGAATGCCTGTATAGATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019673.1-1181s1c1
Sequence:CCGGGCAGGAGGAAACACGCTAATACTCGAGTATTAGCGTGTTTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019673.1-1247s1c1
Sequence:CCGGCCACCAAGTATGCGGTTGAAACTCGAGTTTCAACCGCATACTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-400s21c1
Sequence:CCGGGGACTGCCCTAAGGTTGATTTCTCGAGAAATCAACCTTAGGGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019673.2-1726s21c1
Sequence:CCGGGGCTTTAACTGGCTCTATAAACTCGAGTTTATAGAGCCAGTTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-1048s21c1
Sequence:CCGGTACAAGGTCTTGGCACAATTACTCGAGTAATTGTGCCAAGACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-1384s21c1
Sequence:GTACCGGGAGTTTCACTGACAGGTTAAACTCGAGTTTAACCTGTCAGTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-1234s21c1
Sequence:CCGGATTTGACCCTTCCAACGTAAACTCGAGTTTACGTTGGAAGGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019673
VALIDATED
ACTL6A MISSION shRNA shRNA Plasmid DNA
actin-like 6A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019673.1-1246s1c1
Sequence:CCGGTCCACCAAGTATGCGGTTGAACTCGAGTTCAACCGCATACTTGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019673.1-1591s1c1
Sequence:CCGGGCACTTATCTATACAGGCATTCTCGAGAATGCCTGTATAGATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019673.1-1181s1c1
Sequence:CCGGGCAGGAGGAAACACGCTAATACTCGAGTATTAGCGTGTTTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019673.1-1247s1c1
Sequence:CCGGCCACCAAGTATGCGGTTGAAACTCGAGTTTCAACCGCATACTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-400s21c1
Sequence:CCGGGGACTGCCCTAAGGTTGATTTCTCGAGAAATCAACCTTAGGGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019673.2-1726s21c1
Sequence:CCGGGGCTTTAACTGGCTCTATAAACTCGAGTTTATAGAGCCAGTTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-1048s21c1
Sequence:CCGGTACAAGGTCTTGGCACAATTACTCGAGTAATTGTGCCAAGACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-1384s21c1
Sequence:GTACCGGGAGTTTCACTGACAGGTTAAACTCGAGTTTAACCTGTCAGTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-1234s21c1
Sequence:CCGGATTTGACCCTTCCAACGTAAACTCGAGTTTACGTTGGAAGGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019673
VALIDATED
ACTL6A MISSION shRNA Lentiviral Transduction Particles
actin-like 6A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019673.1-1246s1c1
Sequence:CCGGTCCACCAAGTATGCGGTTGAACTCGAGTTCAACCGCATACTTGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019673.1-1591s1c1
Sequence:CCGGGCACTTATCTATACAGGCATTCTCGAGAATGCCTGTATAGATAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019673.1-1181s1c1
Sequence:CCGGGCAGGAGGAAACACGCTAATACTCGAGTATTAGCGTGTTTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019673.1-1247s1c1
Sequence:CCGGCCACCAAGTATGCGGTTGAAACTCGAGTTTCAACCGCATACTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-400s21c1
Sequence:CCGGGGACTGCCCTAAGGTTGATTTCTCGAGAAATCAACCTTAGGGCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019673.2-1726s21c1
Sequence:CCGGGGCTTTAACTGGCTCTATAAACTCGAGTTTATAGAGCCAGTTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-1048s21c1
Sequence:CCGGTACAAGGTCTTGGCACAATTACTCGAGTAATTGTGCCAAGACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-1384s21c1
Sequence:GTACCGGGAGTTTCACTGACAGGTTAAACTCGAGTTTAACCTGTCAGTGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019673.2-1234s21c1
Sequence:CCGGATTTGACCCTTCCAACGTAAACTCGAGTTTACGTTGGAAGGGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177989
VALIDATED
ACTL6A MISSION shRNA Bacterial Glycerol Stock
actin-like 6A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-314s1c1
Sequence:CCGGCTGGGATAGTTTCCAAGCTATCTCGAGATAGCTTGGAAACTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-1488s1c1
Sequence:CCGGGCTTTCCTTGAAATGCACTTACTCGAGTAAGTGCATTTCAAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-1146s1c1
Sequence:CCGGCCTCCAAGTATGCGGTTGAAACTCGAGTTTCAACCGCATACTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177989.1-227s1c1
Sequence:CCGGCACCTACTACATAGATACTAACTCGAGTTAGTATCTATGTAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-823s1c1
Sequence:CCGGCGGTACTTCAAGTGTCAGATTCTCGAGAATCTGACACTTGAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177989.2-394s21c1
Sequence:CCGGTGTCAGAGGCACCGTGGAATACTCGAGTATTCCACGGTGCCTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177989.2-1354s21c1
Sequence:CCGGACCTTACGTTTCATAGCTTTACTCGAGTAAAGCTATGAAACGTAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177989
VALIDATED
ACTL6A MISSION shRNA shRNA Plasmid DNA
actin-like 6A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-314s1c1
Sequence:CCGGCTGGGATAGTTTCCAAGCTATCTCGAGATAGCTTGGAAACTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-1488s1c1
Sequence:CCGGGCTTTCCTTGAAATGCACTTACTCGAGTAAGTGCATTTCAAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-1146s1c1
Sequence:CCGGCCTCCAAGTATGCGGTTGAAACTCGAGTTTCAACCGCATACTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177989.1-227s1c1
Sequence:CCGGCACCTACTACATAGATACTAACTCGAGTTAGTATCTATGTAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-823s1c1
Sequence:CCGGCGGTACTTCAAGTGTCAGATTCTCGAGAATCTGACACTTGAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177989.2-394s21c1
Sequence:CCGGTGTCAGAGGCACCGTGGAATACTCGAGTATTCCACGGTGCCTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177989.2-1354s21c1
Sequence:CCGGACCTTACGTTTCATAGCTTTACTCGAGTAAAGCTATGAAACGTAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177989
VALIDATED
ACTL6A MISSION shRNA Lentiviral Transduction Particles
actin-like 6A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-314s1c1
Sequence:CCGGCTGGGATAGTTTCCAAGCTATCTCGAGATAGCTTGGAAACTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-1488s1c1
Sequence:CCGGGCTTTCCTTGAAATGCACTTACTCGAGTAAGTGCATTTCAAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-1146s1c1
Sequence:CCGGCCTCCAAGTATGCGGTTGAAACTCGAGTTTCAACCGCATACTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177989.1-227s1c1
Sequence:CCGGCACCTACTACATAGATACTAACTCGAGTTAGTATCTATGTAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_177989.1-823s1c1
Sequence:CCGGCGGTACTTCAAGTGTCAGATTCTCGAGAATCTGACACTTGAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177989.2-394s21c1
Sequence:CCGGTGTCAGAGGCACCGTGGAATACTCGAGTATTCCACGGTGCCTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177989.2-1354s21c1
Sequence:CCGGACCTTACGTTTCATAGCTTTACTCGAGTAAAGCTATGAAACGTAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks