EMAIL THIS PAGE TO A FRIEND

ACTL6B

actin-like 6B

44 Gene Product Result for
Synonyms: ACTL6 BAF53B
UniProtKB ID: O94805, A4D2D0, O75421
Gene ID:
Human(51412) Summary: The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a subunit of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. This subunit may be involved in the regulation of genes by structural modulation of their chromatin, specifically in the brain. [provided by RefSeq, Jul 2008]
Mouse(83766) actin-like 6B
Rat(288563) actin-like 6B
Zebrafish(553775) actin-like 6B
dog(608417) actin-like 6B
cow(504476) actin-like 6B
domestic cat(101093067) actin-like 6B
sheep(101103114) actin-like 6B
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016188 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139251 MISSION® esiRNA esiRNA human ACTL6B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016188 Rosetta Predictions human pricing
NM_001105917 Rosetta Predictions rat pricing
NM_031404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103871 predicted 521
2 SASI_Hs01_00103872 predicted 653
3 SASI_Hs01_00103873 predicted 795
4 SASI_Hs01_00103874 predicted 1145
5 SASI_Hs01_00103875 predicted 1086
6 SASI_Hs01_00103876 predicted 1136
7 SASI_Hs01_00103877 predicted 1061
8 SASI_Hs01_00103878 predicted 1102
9 SASI_Hs01_00103879 predicted 1046
10 SASI_Hs01_00103880 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105917 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213812 predicted 985
2 SASI_Rn02_00213813 predicted 1001
3 SASI_Rn02_00213814 predicted 809
4 SASI_Rn02_00213815 predicted 833
5 SASI_Rn02_00213816 predicted 1112
6 SASI_Rn02_00213817 predicted 908
7 SASI_Rn02_00213818 predicted 984
8 SASI_Rn02_00213819 predicted 696
9 SASI_Rn02_00213820 predicted 1080
10 SASI_Rn02_00213821 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142992 predicted 403
2 SASI_Mm01_00142993 predicted 990
3 SASI_Mm01_00142994 predicted 808
4 SASI_Mm01_00142995 predicted 825
5 SASI_Mm01_00142996 predicted 1107
6 SASI_Mm02_00337153 predicted 613
7 SASI_Mm01_00142997 predicted 995
8 SASI_Mm01_00142998 predicted 1063
9 SASI_Mm01_00142999 predicted 694
10 SASI_Mm01_00143001 predicted 1020
11 SASI_Mm01_00143000 predicted 908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031404
ACTL6B MISSION shRNA Bacterial Glycerol Stock
actin-like 6B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-497s1c1
Sequence:CCGGGCAGTACAACATTCCTGCCTTCTCGAGAAGGCAGGAATGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-1156s1c1
Sequence:CCGGACAGACTTAATCGGGAGCTTTCTCGAGAAAGCTCCCGATTAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-1065s1c1
Sequence:CCGGAGCATCGGCATGTGTGACATTCTCGAGAATGTCACACATGCCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-818s1c1
Sequence:CCGGCTGGCATAACTACATGTGTAACTCGAGTTACACATGTAGTTATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-381s1c1
Sequence:CCGGGATCATACCTACAGCAAACATCTCGAGATGTTTGCTGTAGGTATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031404
ACTL6B MISSION shRNA shRNA Plasmid DNA
actin-like 6B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-497s1c1
Sequence:CCGGGCAGTACAACATTCCTGCCTTCTCGAGAAGGCAGGAATGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-1156s1c1
Sequence:CCGGACAGACTTAATCGGGAGCTTTCTCGAGAAAGCTCCCGATTAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-1065s1c1
Sequence:CCGGAGCATCGGCATGTGTGACATTCTCGAGAATGTCACACATGCCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-818s1c1
Sequence:CCGGCTGGCATAACTACATGTGTAACTCGAGTTACACATGTAGTTATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-381s1c1
Sequence:CCGGGATCATACCTACAGCAAACATCTCGAGATGTTTGCTGTAGGTATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031404
ACTL6B MISSION shRNA Lentiviral Transduction Particles
actin-like 6B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-497s1c1
Sequence:CCGGGCAGTACAACATTCCTGCCTTCTCGAGAAGGCAGGAATGTTGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-1156s1c1
Sequence:CCGGACAGACTTAATCGGGAGCTTTCTCGAGAAAGCTCCCGATTAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-1065s1c1
Sequence:CCGGAGCATCGGCATGTGTGACATTCTCGAGAATGTCACACATGCCGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-818s1c1
Sequence:CCGGCTGGCATAACTACATGTGTAACTCGAGTTACACATGTAGTTATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031404.3-381s1c1
Sequence:CCGGGATCATACCTACAGCAAACATCTCGAGATGTTTGCTGTAGGTATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016188
ACTL6B MISSION shRNA Bacterial Glycerol Stock
actin-like 6B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-810s1c1
Sequence:CCGGCCTGGCATAACTACATGTGTACTCGAGTACACATGTAGTTATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-934s1c1
Sequence:CCGGCAATGGCTACAATACAGACTACTCGAGTAGTCTGTATTGTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-705s1c1
Sequence:CCGGCCATTGACATCATCCCACCTTCTCGAGAAGGTGGGATGATGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-1149s1c1
Sequence:CCGGACAGGCTCAATCGAGAGCTTTCTCGAGAAAGCTCTCGATTGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-379s1c1
Sequence:CCGGCACCTACAGCAAACACGTCAACTCGAGTTGACGTGTTTGCTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016188
ACTL6B MISSION shRNA shRNA Plasmid DNA
actin-like 6B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-810s1c1
Sequence:CCGGCCTGGCATAACTACATGTGTACTCGAGTACACATGTAGTTATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-934s1c1
Sequence:CCGGCAATGGCTACAATACAGACTACTCGAGTAGTCTGTATTGTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-705s1c1
Sequence:CCGGCCATTGACATCATCCCACCTTCTCGAGAAGGTGGGATGATGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-1149s1c1
Sequence:CCGGACAGGCTCAATCGAGAGCTTTCTCGAGAAAGCTCTCGATTGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-379s1c1
Sequence:CCGGCACCTACAGCAAACACGTCAACTCGAGTTGACGTGTTTGCTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016188
ACTL6B MISSION shRNA Lentiviral Transduction Particles
actin-like 6B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-810s1c1
Sequence:CCGGCCTGGCATAACTACATGTGTACTCGAGTACACATGTAGTTATGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-934s1c1
Sequence:CCGGCAATGGCTACAATACAGACTACTCGAGTAGTCTGTATTGTAGCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-705s1c1
Sequence:CCGGCCATTGACATCATCCCACCTTCTCGAGAAGGTGGGATGATGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-1149s1c1
Sequence:CCGGACAGGCTCAATCGAGAGCTTTCTCGAGAAAGCTCTCGATTGAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016188.3-379s1c1
Sequence:CCGGCACCTACAGCAAACACGTCAACTCGAGTTGACGTGTTTGCTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks