EMAIL THIS PAGE TO A FRIEND

ACTL7A

actin-like 7A

62 Gene Product Result for
UniProtKB ID: Q9Y615, B2RC83, Q5JSV0
Gene ID:
Human(10881) Summary: The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene (ACTL7A), and related gene, ACTL7B, are intronless, and are located approximately 4 kb apart in a head-to-head orientation within the familial dysautonomia candidate region on 9q31. Based on mutational analysis of the ACTL7A gene in patients with this disorder, it was concluded that it is unlikely to be involved in the pathogenesis of dysautonomia. The ACTL7A gene is expressed in a wide variety of adult tissues, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Mouse(11470) actin-like 7a
Rat(298017) actin-like 7a
sheep(101115937) actin-like 7A
cow(540296) actin-like 7A
domestic cat(101087109) actin-like 7A
dog(474795) actin-like 7A
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006687 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006687 Rosetta Predictions human pricing
NM_001011973 Rosetta Predictions rat pricing
XM_575827 Rosetta Predictions rat pricing
NM_009611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245192 predicted 879
2 SASI_Hs02_00342099 predicted 690
3 SASI_Hs02_00342100 predicted 529
4 SASI_Hs01_00245193 predicted 1124
5 SASI_Hs01_00245194 predicted 484
6 SASI_Hs01_00245195 predicted 1005
7 SASI_Hs01_00245196 predicted 551
8 SASI_Hs01_00245198 predicted 1163
9 SASI_Hs01_00245199 predicted 282
10 SASI_Hs01_00245200 predicted 437
11 SASI_Hs01_00245197 predicted 754
12 SASI_Hs01_00245201 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114064 predicted 770
2 SASI_Rn01_00114065 predicted 255
3 SASI_Rn02_00199995 predicted 386
4 SASI_Rn01_00114066 predicted 438
5 SASI_Rn01_00114067 predicted 328
6 SASI_Rn01_00114068 predicted 472
7 SASI_Rn01_00114069 predicted 982
8 SASI_Rn01_00114070 predicted 781
9 SASI_Rn01_00114071 predicted 611
10 SASI_Rn01_00114072 predicted 711
11 SASI_Rn01_00114073 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153001 predicted 258
2 SASI_Rn01_00153002 predicted 264
3 SASI_Rn01_00153003 predicted 259
4 SASI_Rn01_00153004 predicted 302
5 SASI_Rn01_00153005 predicted 298
6 SASI_Rn01_00153006 predicted 304
7 SASI_Rn01_00153007 predicted 234
8 SASI_Rn01_00153008 predicted 392
9 SASI_Rn01_00153009 predicted 339
10 SASI_Rn01_00153010 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103423 predicted 243
2 SASI_Mm01_00103424 predicted 867
3 SASI_Mm01_00103425 predicted 223
4 SASI_Mm01_00103426 predicted 513
5 SASI_Mm01_00103427 predicted 831
6 SASI_Mm01_00103428 predicted 1019
7 SASI_Mm01_00103429 predicted 944
8 SASI_Mm01_00103430 predicted 371
9 SASI_Mm01_00103431 predicted 747
10 SASI_Mm01_00103432 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006687
ACTL7A MISSION shRNA Bacterial Glycerol Stock
actin-like 7A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-1023s1c1
Sequence:CCGGCTGCCTTAACAAGTGTGACATCTCGAGATGTCACACTTGTTAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-426s1c1
Sequence:CCGGCTGGGATACAGTGCAGGATATCTCGAGATATCCTGCACTGTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-425s1c1
Sequence:CCGGACTGGGATACAGTGCAGGATACTCGAGTATCCTGCACTGTATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-149s1c1
Sequence:CCGGAGCCACAAGAACCTACTGAATCTCGAGATTCAGTAGGTTCTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-152s1c1
Sequence:CCGGCACAAGAACCTACTGAATCAACTCGAGTTGATTCAGTAGGTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006687.2-331s21c1
Sequence:CCGGGATAATCGCAAGGAGACATTCCTCGAGGAATGTCTCCTTGCGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006687.2-450s21c1
Sequence:CCGGGGAATATCTCTTCCGACAAGACTCGAGTCTTGTCGGAAGAGATATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006687.2-1164s21c1
Sequence:CCGGGGTAAACGTGCTGCCTGAAAGCTCGAGCTTTCAGGCAGCACGTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006687
ACTL7A MISSION shRNA shRNA Plasmid DNA
actin-like 7A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-1023s1c1
Sequence:CCGGCTGCCTTAACAAGTGTGACATCTCGAGATGTCACACTTGTTAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-426s1c1
Sequence:CCGGCTGGGATACAGTGCAGGATATCTCGAGATATCCTGCACTGTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-425s1c1
Sequence:CCGGACTGGGATACAGTGCAGGATACTCGAGTATCCTGCACTGTATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-149s1c1
Sequence:CCGGAGCCACAAGAACCTACTGAATCTCGAGATTCAGTAGGTTCTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-152s1c1
Sequence:CCGGCACAAGAACCTACTGAATCAACTCGAGTTGATTCAGTAGGTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006687.2-331s21c1
Sequence:CCGGGATAATCGCAAGGAGACATTCCTCGAGGAATGTCTCCTTGCGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006687.2-450s21c1
Sequence:CCGGGGAATATCTCTTCCGACAAGACTCGAGTCTTGTCGGAAGAGATATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006687.2-1164s21c1
Sequence:CCGGGGTAAACGTGCTGCCTGAAAGCTCGAGCTTTCAGGCAGCACGTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006687
ACTL7A MISSION shRNA Lentiviral Transduction Particles
actin-like 7A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-1023s1c1
Sequence:CCGGCTGCCTTAACAAGTGTGACATCTCGAGATGTCACACTTGTTAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-426s1c1
Sequence:CCGGCTGGGATACAGTGCAGGATATCTCGAGATATCCTGCACTGTATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-425s1c1
Sequence:CCGGACTGGGATACAGTGCAGGATACTCGAGTATCCTGCACTGTATCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-149s1c1
Sequence:CCGGAGCCACAAGAACCTACTGAATCTCGAGATTCAGTAGGTTCTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006687.2-152s1c1
Sequence:CCGGCACAAGAACCTACTGAATCAACTCGAGTTGATTCAGTAGGTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006687.2-331s21c1
Sequence:CCGGGATAATCGCAAGGAGACATTCCTCGAGGAATGTCTCCTTGCGATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006687.2-450s21c1
Sequence:CCGGGGAATATCTCTTCCGACAAGACTCGAGTCTTGTCGGAAGAGATATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006687.2-1164s21c1
Sequence:CCGGGGTAAACGTGCTGCCTGAAAGCTCGAGCTTTCAGGCAGCACGTTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009611
ACTL7A MISSION shRNA Bacterial Glycerol Stock
actin-like 7A
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-403s1c1
Sequence:CCGGCGAGCTCTTTAACCCAGATATCTCGAGATATCTGGGTTAAAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-808s1c1
Sequence:CCGGCCTGATGAACAACTCTGGAAACTCGAGTTTCCAGAGTTGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-233s1c1
Sequence:CCGGCCAAGACTAGAGGTAACCAAACTCGAGTTTGGTTACCTCTAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-926s1c1
Sequence:CCGGCCTGAACATGAGATCCATTATCTCGAGATAATGGATCTCATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-796s1c1
Sequence:CCGGCTACCTGATGAACCTGATGAACTCGAGTTCATCAGGTTCATCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009611.3-1332s21c1
Sequence:CCGGTACGAGGAACATGGGCCTTTCCTCGAGGAAAGGCCCATGTTCCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009611
ACTL7A MISSION shRNA shRNA Plasmid DNA
actin-like 7A
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-403s1c1
Sequence:CCGGCGAGCTCTTTAACCCAGATATCTCGAGATATCTGGGTTAAAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-808s1c1
Sequence:CCGGCCTGATGAACAACTCTGGAAACTCGAGTTTCCAGAGTTGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-233s1c1
Sequence:CCGGCCAAGACTAGAGGTAACCAAACTCGAGTTTGGTTACCTCTAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-926s1c1
Sequence:CCGGCCTGAACATGAGATCCATTATCTCGAGATAATGGATCTCATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-796s1c1
Sequence:CCGGCTACCTGATGAACCTGATGAACTCGAGTTCATCAGGTTCATCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009611.3-1332s21c1
Sequence:CCGGTACGAGGAACATGGGCCTTTCCTCGAGGAAAGGCCCATGTTCCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009611
ACTL7A MISSION shRNA Lentiviral Transduction Particles
actin-like 7A
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-403s1c1
Sequence:CCGGCGAGCTCTTTAACCCAGATATCTCGAGATATCTGGGTTAAAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-808s1c1
Sequence:CCGGCCTGATGAACAACTCTGGAAACTCGAGTTTCCAGAGTTGTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-233s1c1
Sequence:CCGGCCAAGACTAGAGGTAACCAAACTCGAGTTTGGTTACCTCTAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-926s1c1
Sequence:CCGGCCTGAACATGAGATCCATTATCTCGAGATAATGGATCTCATGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009611.1-796s1c1
Sequence:CCGGCTACCTGATGAACCTGATGAACTCGAGTTCATCAGGTTCATCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009611.3-1332s21c1
Sequence:CCGGTACGAGGAACATGGGCCTTTCCTCGAGGAAAGGCCCATGTTCCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks