EMAIL THIS PAGE TO A FRIEND

ACTL7B

actin-like 7B

51 Gene Product Result for
Synonyms: Tact1
UniProtKB ID: Q9Y614, B2R9Q2, Q5JSV1
Gene ID:
Human(10880) Summary: The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene (ACTL7B), and related gene, ACTL7A, are intronless, and are located approximately 4 kb apart in a head-to-head orientation within the familial dysautonomia candidate region on 9q31. Based on mutational analysis of the ACTL7B gene in patients with this disorder, it was concluded that it is unlikely to be involved in the pathogenesis of dysautonomia. Unlike ACTL7A, the ACTL7B gene is expressed predominantly in the testis, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Mouse(11471) actin-like 7b
Rat(313183) actin-like 7b
cow(515059) actin-like 7B
domestic cat(101086856) actin-like 7B
dog(481658) actin-like 7B
sheep(101116203) actin-like 7B
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006686 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015841 MISSION® esiRNA esiRNA targeting human ACTL7B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006686 Rosetta Predictions human pricing
NM_001025417 Rosetta Predictions rat pricing
NM_025271 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173666 predicted 482
2 SASI_Hs01_00173667 predicted 295
3 SASI_Hs01_00173668 predicted 1013
4 SASI_Hs01_00173669 predicted 535
5 SASI_Hs01_00173670 predicted 373
6 SASI_Hs01_00173671 predicted 519
7 SASI_Hs01_00173672 predicted 685
8 SASI_Hs01_00173673 predicted 544
9 SASI_Hs01_00173674 predicted 1024
10 SASI_Hs01_00173675 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039729 predicted 422
2 SASI_Rn01_00039730 predicted 785
3 SASI_Rn01_00039731 predicted 389
4 SASI_Rn01_00039733 predicted 532
5 SASI_Rn01_00039734 predicted 396
6 SASI_Rn01_00039736 predicted 734
7 SASI_Rn01_00039737 predicted 584
8 SASI_Rn01_00039738 predicted 316
9 SASI_Rn02_00203154 predicted 256
10 SASI_Rn02_00203155 predicted 554
11 SASI_Rn01_00039732 predicted 948
12 SASI_Rn01_00039735 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051249 predicted 454
2 SASI_Mm01_00051250 predicted 425
3 SASI_Mm02_00327874 predicted 439
4 SASI_Mm01_00051251 predicted 427
5 SASI_Mm01_00051252 predicted 761
6 SASI_Mm01_00051253 predicted 388
7 SASI_Mm01_00051254 predicted 1200
8 SASI_Mm01_00051255 predicted 772
9 SASI_Mm01_00051256 predicted 658
10 SASI_Mm01_00051257 predicted 817
11 SASI_Mm01_00051258 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006686
ACTL7B MISSION shRNA Bacterial Glycerol Stock
actin-like 7B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006686.3-550s21c1
Sequence:CCGGAGTACGCGGAGCTCATGTTTGCTCGAGCAAACATGAGCTCCGCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006686.3-336s21c1
Sequence:CCGGGACACCCGCAAGTGGACTTTACTCGAGTAAAGTCCACTTGCGGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-853s1c1
Sequence:CCGGGACGGCAAACTCATCACTATTCTCGAGAATAGTGATGAGTTTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-851s1c1
Sequence:CCGGCGGACGGCAAACTCATCACTACTCGAGTAGTGATGAGTTTGCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-141s1c1
Sequence:CCGGCAAGATCAAGGCGGTCATCATCTCGAGATGATGACCGCCTTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-882s1c1
Sequence:CCGGGCGCTTCCGTTGCTCTGAGATCTCGAGATCTCAGAGCAACGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-546s1c1
Sequence:CCGGGTTGCTGTCCATCTACTCCTACTCGAGTAGGAGTAGATGGACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006686
ACTL7B MISSION shRNA shRNA Plasmid DNA
actin-like 7B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006686.3-550s21c1
Sequence:CCGGAGTACGCGGAGCTCATGTTTGCTCGAGCAAACATGAGCTCCGCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006686.3-336s21c1
Sequence:CCGGGACACCCGCAAGTGGACTTTACTCGAGTAAAGTCCACTTGCGGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-853s1c1
Sequence:CCGGGACGGCAAACTCATCACTATTCTCGAGAATAGTGATGAGTTTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-851s1c1
Sequence:CCGGCGGACGGCAAACTCATCACTACTCGAGTAGTGATGAGTTTGCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-141s1c1
Sequence:CCGGCAAGATCAAGGCGGTCATCATCTCGAGATGATGACCGCCTTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-882s1c1
Sequence:CCGGGCGCTTCCGTTGCTCTGAGATCTCGAGATCTCAGAGCAACGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-546s1c1
Sequence:CCGGGTTGCTGTCCATCTACTCCTACTCGAGTAGGAGTAGATGGACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006686
ACTL7B MISSION shRNA Lentiviral Transduction Particles
actin-like 7B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006686.3-550s21c1
Sequence:CCGGAGTACGCGGAGCTCATGTTTGCTCGAGCAAACATGAGCTCCGCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006686.3-336s21c1
Sequence:CCGGGACACCCGCAAGTGGACTTTACTCGAGTAAAGTCCACTTGCGGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-853s1c1
Sequence:CCGGGACGGCAAACTCATCACTATTCTCGAGAATAGTGATGAGTTTGCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-851s1c1
Sequence:CCGGCGGACGGCAAACTCATCACTACTCGAGTAGTGATGAGTTTGCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-141s1c1
Sequence:CCGGCAAGATCAAGGCGGTCATCATCTCGAGATGATGACCGCCTTGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-882s1c1
Sequence:CCGGGCGCTTCCGTTGCTCTGAGATCTCGAGATCTCAGAGCAACGGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006686.2-546s1c1
Sequence:CCGGGTTGCTGTCCATCTACTCCTACTCGAGTAGGAGTAGATGGACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025271
ACTL7B MISSION shRNA Bacterial Glycerol Stock
actin-like 7B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-439s1c1
Sequence:CCGGCCAGAACATCTGGGAGTACATCTCGAGATGTACTCCCAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-270s1c1
Sequence:CCGGCCACCTATTTCATCTCCTCTACTCGAGTAGAGGAGATGAAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-269s1c1
Sequence:CCGGCCCACCTATTTCATCTCCTCTCTCGAGAGAGGAGATGAAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-608s1c1
Sequence:CCGGCTGCTGTCCATCTACTCATATCTCGAGATATGAGTAGATGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-607s1c1
Sequence:CCGGGCTGCTGTCCATCTACTCATACTCGAGTATGAGTAGATGGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025271
ACTL7B MISSION shRNA shRNA Plasmid DNA
actin-like 7B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-439s1c1
Sequence:CCGGCCAGAACATCTGGGAGTACATCTCGAGATGTACTCCCAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-270s1c1
Sequence:CCGGCCACCTATTTCATCTCCTCTACTCGAGTAGAGGAGATGAAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-269s1c1
Sequence:CCGGCCCACCTATTTCATCTCCTCTCTCGAGAGAGGAGATGAAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-608s1c1
Sequence:CCGGCTGCTGTCCATCTACTCATATCTCGAGATATGAGTAGATGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-607s1c1
Sequence:CCGGGCTGCTGTCCATCTACTCATACTCGAGTATGAGTAGATGGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025271
ACTL7B MISSION shRNA Lentiviral Transduction Particles
actin-like 7B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-439s1c1
Sequence:CCGGCCAGAACATCTGGGAGTACATCTCGAGATGTACTCCCAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-270s1c1
Sequence:CCGGCCACCTATTTCATCTCCTCTACTCGAGTAGAGGAGATGAAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-269s1c1
Sequence:CCGGCCCACCTATTTCATCTCCTCTCTCGAGAGAGGAGATGAAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-608s1c1
Sequence:CCGGCTGCTGTCCATCTACTCATATCTCGAGATATGAGTAGATGGACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025271.1-607s1c1
Sequence:CCGGGCTGCTGTCCATCTACTCATACTCGAGTATGAGTAGATGGACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks