EMAIL THIS PAGE TO A FRIEND

ACTL8

actin-like 8

22 Gene Product Result for
Synonyms: CT57
UniProtKB ID: Q9H568, Q13104, Q96M75
Gene ID:
sheep(101106921) actin-like 8
dog(487410) actin-like 8
cow(528048) actin-like 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030812 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030812 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030812 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083361 MISSION® esiRNA esiRNA human ACTL8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030812 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220722 predicted 1084
2 SASI_Hs02_00358390 predicted 1295
3 SASI_Hs01_00220723 predicted 810
4 SASI_Hs01_00220725 predicted 693
5 SASI_Hs02_00358391 predicted 416
6 SASI_Hs01_00220726 predicted 722
7 SASI_Hs01_00220727 predicted 572
8 SASI_Hs01_00220728 predicted 514
9 SASI_Hs01_00220729 predicted 723
10 SASI_Hs01_00220730 predicted 859
11 SASI_Hs01_00220724 predicted 330
12 SASI_Hs01_00220731 predicted 1233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030812
ACTL8 MISSION shRNA Bacterial Glycerol Stock
actin-like 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030812.1-1694s1c1
Sequence:CCGGCAGTTGACATTTCTGGTCCTACTCGAGTAGGACCAGAAATGTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-522s1c1
Sequence:CCGGGCTGGAGATCCTGTTTGAGTTCTCGAGAACTCAAACAGGATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-726s1c1
Sequence:CCGGCTATCTCCTCAAGAGTCTCTTCTCGAGAAGAGACTCTTGAGGAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-1095s1c1
Sequence:CCGGCGGGTTCACAAAGCGCCTGTTCTCGAGAACAGGCGCTTTGTGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-268s1c1
Sequence:CCGGCCGAACATCGTGAACTACCTACTCGAGTAGGTAGTTCACGATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030812.2-1202s21c1
Sequence:CCGGAGGGTTCCAATAGAAACTTTACTCGAGTAAAGTTTCTATTGGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030812.2-449s21c1
Sequence:CCGGTGCAGTACCTCTGGTCATTTGCTCGAGCAAATGACCAGAGGTACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030812
ACTL8 MISSION shRNA shRNA Plasmid DNA
actin-like 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030812.1-1694s1c1
Sequence:CCGGCAGTTGACATTTCTGGTCCTACTCGAGTAGGACCAGAAATGTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-522s1c1
Sequence:CCGGGCTGGAGATCCTGTTTGAGTTCTCGAGAACTCAAACAGGATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-726s1c1
Sequence:CCGGCTATCTCCTCAAGAGTCTCTTCTCGAGAAGAGACTCTTGAGGAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-1095s1c1
Sequence:CCGGCGGGTTCACAAAGCGCCTGTTCTCGAGAACAGGCGCTTTGTGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-268s1c1
Sequence:CCGGCCGAACATCGTGAACTACCTACTCGAGTAGGTAGTTCACGATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030812.2-1202s21c1
Sequence:CCGGAGGGTTCCAATAGAAACTTTACTCGAGTAAAGTTTCTATTGGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030812.2-449s21c1
Sequence:CCGGTGCAGTACCTCTGGTCATTTGCTCGAGCAAATGACCAGAGGTACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030812
ACTL8 MISSION shRNA Lentiviral Transduction Particles
actin-like 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030812.1-1694s1c1
Sequence:CCGGCAGTTGACATTTCTGGTCCTACTCGAGTAGGACCAGAAATGTCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-522s1c1
Sequence:CCGGGCTGGAGATCCTGTTTGAGTTCTCGAGAACTCAAACAGGATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-726s1c1
Sequence:CCGGCTATCTCCTCAAGAGTCTCTTCTCGAGAAGAGACTCTTGAGGAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-1095s1c1
Sequence:CCGGCGGGTTCACAAAGCGCCTGTTCTCGAGAACAGGCGCTTTGTGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030812.1-268s1c1
Sequence:CCGGCCGAACATCGTGAACTACCTACTCGAGTAGGTAGTTCACGATGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030812.2-1202s21c1
Sequence:CCGGAGGGTTCCAATAGAAACTTTACTCGAGTAAAGTTTCTATTGGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030812.2-449s21c1
Sequence:CCGGTGCAGTACCTCTGGTCATTTGCTCGAGCAAATGACCAGAGGTACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks