EMAIL THIS PAGE TO A FRIEND

ACTL9

actin-like 9

49 Gene Product Result for
UniProtKB ID: Q8TC94, A8K893, Q6X960
Gene ID:
Mouse(69481) actin-like 9
Rat(314659) actin-like 9
chicken(428337) actin-like 9
dog(485013) actin-like 9
cow(540051) actin-like 9
sheep(101104573) actin-like 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178525 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178525 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178525 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126181 MISSION® esiRNA esiRNA human ACTL9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178525 Rosetta Predictions human pricing
NM_001108077 Rosetta Predictions rat pricing
NM_183282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369770 predicted 580
2 SASI_Hs01_00039705 predicted 1081
3 SASI_Hs01_00039706 predicted 856
4 SASI_Hs01_00039707 predicted 862
5 SASI_Hs01_00039709 predicted 637
6 SASI_Hs01_00039710 predicted 1073
7 SASI_Hs01_00039711 predicted 1085
8 SASI_Hs01_00039712 predicted 789
9 SASI_Hs01_00039713 predicted 1074
10 SASI_Hs01_00039714 predicted 865
11 SASI_Hs01_00039708 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235124 predicted 687
2 SASI_Rn02_00235125 predicted 605
3 SASI_Rn02_00235126 predicted 260
4 SASI_Rn02_00235127 predicted 440
5 SASI_Rn02_00235128 predicted 399
6 SASI_Rn02_00235129 predicted 321
7 SASI_Rn02_00235130 predicted 615
8 SASI_Rn02_00235131 predicted 484
9 SASI_Rn02_00235132 predicted 238
10 SASI_Rn02_00235133 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097175 predicted 603
2 SASI_Mm01_00097177 predicted 397
3 SASI_Mm01_00097178 predicted 238
4 SASI_Mm01_00097179 predicted 597
5 SASI_Mm01_00097180 predicted 579
6 SASI_Mm01_00097181 predicted 1125
7 SASI_Mm01_00097183 predicted 552
8 SASI_Mm01_00097184 predicted 872
9 SASI_Mm02_00350381 predicted 408
10 SASI_Mm02_00350382 predicted 1055
11 SASI_Mm01_00097176 predicted 481
12 SASI_Mm01_00097182 predicted 1062
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183282
ACTL9 MISSION shRNA Bacterial Glycerol Stock
actin-like 9
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183282.2-242s21c1
Sequence:CCGGGCACCTGTAAGGTAGGCTTTGCTCGAGCAAAGCCTACCTTACAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183282.2-1256s21c1
Sequence:CCGGGGGTCCTACGGGAACAATATGCTCGAGCATATTGTTCCCGTAGGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-1125s1c1
Sequence:CCGGGCAGAGCTACTGCATTCTCTACTCGAGTAGAGAATGCAGTAGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-1136s1c1
Sequence:CCGGGCATTCTCTATCACCTGAGGACTCGAGTCCTCAGGTGATAGAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-977s1c1
Sequence:CCGGGATTCCAGGATTGTCGCCCATCTCGAGATGGGCGACAATCCTGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-1065s1c1
Sequence:CCGGCGGAATGTGATACTATGCGGACTCGAGTCCGCATAGTATCACATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-810s1c1
Sequence:CCGGGTGGAGAACATCAAACATCATCTCGAGATGATGTTTGATGTTCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183282
ACTL9 MISSION shRNA shRNA Plasmid DNA
actin-like 9
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183282.2-242s21c1
Sequence:CCGGGCACCTGTAAGGTAGGCTTTGCTCGAGCAAAGCCTACCTTACAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183282.2-1256s21c1
Sequence:CCGGGGGTCCTACGGGAACAATATGCTCGAGCATATTGTTCCCGTAGGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-1125s1c1
Sequence:CCGGGCAGAGCTACTGCATTCTCTACTCGAGTAGAGAATGCAGTAGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-1136s1c1
Sequence:CCGGGCATTCTCTATCACCTGAGGACTCGAGTCCTCAGGTGATAGAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-977s1c1
Sequence:CCGGGATTCCAGGATTGTCGCCCATCTCGAGATGGGCGACAATCCTGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-1065s1c1
Sequence:CCGGCGGAATGTGATACTATGCGGACTCGAGTCCGCATAGTATCACATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-810s1c1
Sequence:CCGGGTGGAGAACATCAAACATCATCTCGAGATGATGTTTGATGTTCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183282
ACTL9 MISSION shRNA Lentiviral Transduction Particles
actin-like 9
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183282.2-242s21c1
Sequence:CCGGGCACCTGTAAGGTAGGCTTTGCTCGAGCAAAGCCTACCTTACAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183282.2-1256s21c1
Sequence:CCGGGGGTCCTACGGGAACAATATGCTCGAGCATATTGTTCCCGTAGGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-1125s1c1
Sequence:CCGGGCAGAGCTACTGCATTCTCTACTCGAGTAGAGAATGCAGTAGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-1136s1c1
Sequence:CCGGGCATTCTCTATCACCTGAGGACTCGAGTCCTCAGGTGATAGAGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-977s1c1
Sequence:CCGGGATTCCAGGATTGTCGCCCATCTCGAGATGGGCGACAATCCTGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-1065s1c1
Sequence:CCGGCGGAATGTGATACTATGCGGACTCGAGTCCGCATAGTATCACATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183282.1-810s1c1
Sequence:CCGGGTGGAGAACATCAAACATCATCTCGAGATGATGTTTGATGTTCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178525
ACTL9 MISSION shRNA Bacterial Glycerol Stock
actin-like 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178525.3-592s21c1
Sequence:CCGGCAACCGCGAGAAGCTAGTGGACTCGAGTCCACTAGCTTCTCGCGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178525.3-943s21c1
Sequence:CCGGGGAGTACAAGCGGACTCTGAACTCGAGTTCAGAGTCCGCTTGTACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178525.3-1352s21c1
Sequence:CCGGGTGTACCGCAAATGCTACTGACTCGAGTCAGTAGCATTTGCGGTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-1242s1c1
Sequence:CCGGCCACCAGGAATTTCTCCGTATCTCGAGATACGGAGAAATTCCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-864s1c1
Sequence:CCGGTGGACCTAGTGGAGAACATTACTCGAGTAATGTTCTCCACTAGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-295s1c1
Sequence:CCGGAGGCACCTGTAAGGTAGGTTTCTCGAGAAACCTACCTTACAGGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-875s1c1
Sequence:CCGGGAGAACATTAAGCACCACTATCTCGAGATAGTGGTGCTTAATGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-1090s1c1
Sequence:CCGGCCGCAAGTTGTCACTGGAGATCTCGAGATCTCCAGTGACAACTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178525
ACTL9 MISSION shRNA shRNA Plasmid DNA
actin-like 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178525.3-592s21c1
Sequence:CCGGCAACCGCGAGAAGCTAGTGGACTCGAGTCCACTAGCTTCTCGCGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178525.3-943s21c1
Sequence:CCGGGGAGTACAAGCGGACTCTGAACTCGAGTTCAGAGTCCGCTTGTACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178525.3-1352s21c1
Sequence:CCGGGTGTACCGCAAATGCTACTGACTCGAGTCAGTAGCATTTGCGGTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-1242s1c1
Sequence:CCGGCCACCAGGAATTTCTCCGTATCTCGAGATACGGAGAAATTCCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-864s1c1
Sequence:CCGGTGGACCTAGTGGAGAACATTACTCGAGTAATGTTCTCCACTAGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-295s1c1
Sequence:CCGGAGGCACCTGTAAGGTAGGTTTCTCGAGAAACCTACCTTACAGGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-875s1c1
Sequence:CCGGGAGAACATTAAGCACCACTATCTCGAGATAGTGGTGCTTAATGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-1090s1c1
Sequence:CCGGCCGCAAGTTGTCACTGGAGATCTCGAGATCTCCAGTGACAACTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178525
ACTL9 MISSION shRNA Lentiviral Transduction Particles
actin-like 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178525.3-592s21c1
Sequence:CCGGCAACCGCGAGAAGCTAGTGGACTCGAGTCCACTAGCTTCTCGCGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178525.3-943s21c1
Sequence:CCGGGGAGTACAAGCGGACTCTGAACTCGAGTTCAGAGTCCGCTTGTACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178525.3-1352s21c1
Sequence:CCGGGTGTACCGCAAATGCTACTGACTCGAGTCAGTAGCATTTGCGGTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-1242s1c1
Sequence:CCGGCCACCAGGAATTTCTCCGTATCTCGAGATACGGAGAAATTCCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-864s1c1
Sequence:CCGGTGGACCTAGTGGAGAACATTACTCGAGTAATGTTCTCCACTAGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-295s1c1
Sequence:CCGGAGGCACCTGTAAGGTAGGTTTCTCGAGAAACCTACCTTACAGGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-875s1c1
Sequence:CCGGGAGAACATTAAGCACCACTATCTCGAGATAGTGGTGCTTAATGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178525.2-1090s1c1
Sequence:CCGGCCGCAAGTTGTCACTGGAGATCTCGAGATCTCCAGTGACAACTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)